Detailed Information [112486]

Strain Information
DGRC Number 112486
Genotype with FlyBase Link y[*] P{w[+mW.hs]=GawB}CG3638[NP1072] w[*] / FM7c
Genotype y* P{w+mW.hs=GawB}CG3638NP1072 w* / FM7c
Break points/Insertion Site 1E4
Map Viewer
Related Genes EG:BACR42I17.11 EG:33C11.2 EG:33C11.3
Original Number 1072
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP1072

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 30
General Information NP_lines
Embryonic Expression muscle subset (SG)
Larval GFP sg
Larval X-gal sg, gut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np19085_0807
Strand Minus
Insertion Point 992660
Chromosome Band X
Flanking Sequence
ttnttnggggaaaaaacccctttttggggncnnnnaaaagccccggctatcgacgggacc
actttatgttatttcatcatgGTTAATGCATTGCATGTTAAAACTGAGTTGACGCAACTG
TGCTCTCCCTACGCTCTCTCTCTCTCTCCGCTACTCTCTTTCCGGGGGCGGGCTCTGTCG
CTGTCAGAAAAGTCTATTTAAAGCAACCCGCGNNTTTTTTTCTCTTTTTGGTAATTGGCA
CTTCTGAACCCGCGCCGACGGGTTTGTCAATCCGCAAGGANCCGAANTCCGAANTCCCGA
AATCTTCGAAATAATTTTCNAACTCNGACAGAGGGCAGNGGTTTTCGTTTNCCGCAATCN
CCGGGCTGGAAAACATATATCCCGTGGCATCTAACCCGGATTGCGGGCAGGGAAAGCCCC
GTTTATCAGGAGGATGTTCTGATATATTCCCTAAGCNCCTCANACGGTAGAAAGTGGGGG
AAGGAGTAAAAAAGCAGGAGGNGGTTGCGAATCGGACCNAATCGAAAACNAAACGGGTCG
GGGTTTGAAACGAAACGGNAAATGAAAAAACGCCCTGAACGCCCGACTTACGGCTACTAA
ATCGAGCTAAACCCCCGATCGAANAAACATAAGAGAGAACCGCCGCCAAANAACCCATTA
TTGTNGGGGGCCCGTTTTNAGGAAGGGCAAGCCATCCGACATGTNATCCTTTTNAGACCA
ATCAAATCCATGAAGAGCCTCCCTGGGCATAAAATCCAACGGAATTGGGGGAGTTATNAT
GAAGAGCTGCCCGGGNNAATcganacagncaactgtntttgacccttggnaccactctct
tnccgangagganggcncacttattctntgctggctcaanggtagaggcatatnagtcnc
ntacccnnnnnnnnnnngggggggnnnnnnnnnnnnn


CLOSE