Detailed Information [112498]

Strain Information
DGRC Number 112498
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}RhoGAP18B[NP1089] / FM7c
Genotype y* w* P{w+mW.hs=GawB}RhoGAP18BNP1089 / FM7c
Break points/Insertion Site 18A3; -; 18A4
Map Viewer
Related Genes RhoGAP18B CG7502 inx5 412{}165
Original Number 1089
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP1089

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 439
General Information NP_lines
Embryonic Expression epi stripe (ventral thorax) (SG)
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np19165_0807
Strand Plus
Insertion Point 18884541
Chromosome Band X
Flanking Sequence
gtttttttttnnngnnattancttgggggtgncactanacccctttntttgtgtacttnc
ggtaaagccttcggctatcgacgggcaccaccttatgttatttcatcatgATCGAAGAAT
ACATAAGNAGAGAACCGNCGNCAAAGAACCCATTATTGTTGGGGTCCGTTTTCAGGAAGG
GCAAGCCATCCGACATGTCATCCTNTTCAGACCAATCAAATCCATGAAGAGCATCCCTGG
NCNTAAAATCCAACGGAATTGTGGAGTTATCATGATGAGCTGCCGAGTCAATCGATACAG
TCAACTGTCTTTGACCTTTGTTACTACTCTCTTTCGATGATGATGTCGCACTTATTCTAT
GCTGTCTCAATGTTAGAGGCATATCAGTCTCCACTGAAGCCATCTTTNTTTTTGGGGNTN
CACGGTTGNGCGCTCTNTTNTGCTGCANNTTTCGTTTAAAGTCCTTGACCAACTTNGCCT
GCTCGNNCGNACACTTTGCACTTNTNCTNCGNGCTTNTNCGNANNGNGACCGNGCTCTNC
TNGGNGGNGGATGAAGGATNNNNNAATCNTNNNANANAACCGNNNNCAAANAACCCATTA
TTGNNGGGGNNCGNNNTNANGAAGGGNNNNCCNTNCNNCATGNNATNCTNNTTNANACCA
ANNNANTNCNTNNNNAGCNTNCNTGGNNNTAAAANNCAACGNNNTNGNGGNNNNNTNATG
ANNNGNTNNCNNNNNNANNNNNNCNNNNNANNGNNNNTNNCCTTNNNNNCTACNNNNTTN
CNNNNNNNANNNNNNNCTNNtnntatnnnnnnnnaangnnnnaggcntnnnannntnnct
gagcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE