Detailed Information [112511]

Strain Information
DGRC Number 112511
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP1109 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP1109 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 38E1
Map Viewer
Related Genes Hr38 CG9316
Original Number 1109
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1109

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1270
General Information NP_lines
Embryonic Expression muscle subset (SG)
Larval GFP DT fusion cells
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np17405_0807
Strand Plus
Insertion Point 20685908
Chromosome Band 2L
Flanking Sequence
ttttcgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccacc
ttatgttatttcatcatgGTCTTGGCGCTCGGCACCCGAACCCAAATCCAAATCTTCGGg
atcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttt
tcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagag
catccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaa
tcgatacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcac
ttattctatgctgtctcaatgttagaggcatatcagtctccactgagcatcttttttttn
ggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE