Detailed Information [112518]

Strain Information
DGRC Number 112518
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP1120 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP1120 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 42E5
Map Viewer
Related Genes Tsp42Ee Tsp42Eg Tsp42Ef
Original Number 1120
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1120

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 551
General Information NP_lines
Embryonic Expression pns larage subset
Larval GFP cns, gut
Larval X-gal gut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np03125_0711
Strand Plus
Insertion Point 2085881
Chromosome Band 2R
Flanking Sequence
antgaccttgngtgccactgaactttannttggtatacttcggtaagcttcggctatcga
cgggaccaccttatgttatttcatcatgNGATAGAGNTAGCCGNCNGTGNAAGCGCCNTT
CANNGAATTTNTAGCCGACGGACAGACCGNACCTGATCGAAGAATACATAANANAGAACC
GTNCCCAAAGAACCCATTATTGNTGGGGTCCGTNTTCAGGAAGGGCANGCCATCCGACAT
GTCATCCTCTTCAGACCAATCAAATCCATGAAGAGCATCCCTGGGCATAAAATCCAACGG
AATTGTGGAGTTATCATGATGAGCTGCCGAGTCAATCGATACAGTCAACTGTCTTTGACC
TTTGTTACTACTCTCTTCCGATGATGATGTCGCACTTATTCTATGCTGTCTCAATGTTAG
AGGCATATCAGTCTCCACTGAGCATCNNNNNNNTGGGGNNNGNNNCNATGNAANNANGNN
NNACCTTATTCTATGNCTGNCTNAATGCNANNGGCATATCANCCTCCACTGAAGCCATNN
NNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNGNAANNNNANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnn


CLOSE