Detailed Information [112548]
 

Strain Information
DGRC Number 112548
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP1171 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP1171 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 35D1; -; 35D2
Map Viewer
Related Genes CG15258 nht esg
Original Number 1171
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1171

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1199
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality semi lethal
Embryonic Expression scattered cells
Larval GFP esg-like
Larval X-gal weak
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np03475_0711
Strand Plus
Insertion Point 15310914
Chromosome Band 2L
Flanking Sequence
atttttaacgtgccactgnntttaantgtatacttcggtaagcttcggctatcgacggga
ccaccttatgttatttcatcatgGCTTGGCTCTTTCTAAACGTTCTAGTTGTATATTTAC
CGTATTGTATTTCTGAGAAATTTTCCTATTTTTTTAAAATTTTTTCTGGGTATTTGGACA
AAATCGAATCAAATCCAAGTCGTAAAATTCTCGCCAATTCGATTACCGGAACATGCCCGC
AGAAAAAAATTCTATATCATTATCTAATGATGAATTACAGAATAATCATATTAGTACGCC
GAAGTAGTAAAGCTATTAATTTATTATAAATATTCCTAAGgatcgaagaatacataagag
agaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatc
cgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatc
caacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtct
ttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctcaa
tgttagaggcatatcagtctcacngctcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnn

CLOSE