Detailed Information [112578]
 

Strain Information
DGRC Number 112578
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Vha16[NP1231] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
y* w*; P{w+mW.hs=GawB}Vha16NP1231 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 42C1
Map Viewer
Related Genes Trap1 Vha16 invader1{}757
Original Number 1231
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1231

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 536
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression weak
Larval GFP gut
Larval X-gal mt
Adult GFP abdomen
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np03825_0711
Strand Plus
Insertion Point 1693497
Chromosome Band 2R
Flanking Sequence
atttttggtgcctgcctttatttgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgGGCACACATCACGGATAGTAAGTCCAATTGGCAATGACAAC
GGTCTGGAAAATTACACACGTACACACAATCACATGGGAGCTGTTAAAACCCTGGTTTCC
AGGCTTTTGCAAAATGAAAATGCAATTTTTGCACTTTCTGAAGATGCCTGTGCTCCTTGT
TCAATTCCCATTGCTCAACGCGCAAAACTCACACTCACAAGGAATCTCATTGTCATTGGC
TAAGTGTGGCTTGCCTGTGTGTGTGCATGTCGTGGCAGAAAATATTGTACAATTTTTTTT
CTGTTTGAACTCTGTTCAAATTCAAGTTGTCGCAGCAGCATGTTTTATCGCAGGCCCGAA
ACTTTTCCGCAGGGCTAGCCTCACATGACCGCCTATCTTTTGACTGCTTTTTCACTCACG
TGATTAGAAATCTAATTAAAAGCAATTCGCTGCTCTGNGGCCTCTTTCGGGTTACTGNTG
GCTGCTGCTTAAAAGCGCNGATCGAAAAATACATAAGANAGAACCGTCGCCCAAGAACCC
CATTATTGGTNGGGGTCCGNTTTCAAGGAAGGCAAGCCATTCGACATGGTATTCCTTTTT
AGACCCATCAAATTCCTGAAGAGCCTTCCTGGGCCTAAAAANCAACGGGATTGGGGGAGT
TATTATGATGAGCTGGCCAGTCAATCGAACCAGNCAACTGGCTTGACCCTTGGTACTACT
CTNTTNCGAGGAGAAGGCCCacttatttntgctggctcaaggtagagnatatnnctccnc
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Embryo

e1 (->Large)

CLOSE