Detailed Information [112607]

Strain Information
DGRC Number 112607
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP1287 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP1287 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 55F8
Map Viewer
Related Genes Jheh1 Jheh2 Bari1{}855
Original Number 1287
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1287

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 860
General Information NP_lines
Embryonic Expression sg
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np20675_0807
Strand Plus
Insertion Point 13921705
Chromosome Band 2R
Flanking Sequence
GTTCTTCGGNAGCTTCGGCTTCGACGGGACCCCTTATGTTATTTATNATGGATTGGACAA
ATAATTTGAGAATTTCGGCGAGCTTTTGGCAACAAATTGAGTGAGAGCAATTTTTGTACT
TAAAATTTACATTTAGTTTAGGAAGATGATCGAAGAATACATAAGAGAGAACCGTCGCCA
AAGAACCCATTATTGTTGGGGTCCGTTTTCAGGAAGGGCAAGCCATCCGACATGTCATCC
TCTTCAGACCAATCAAATCCATGAAGAGCATCCCTGGGCATAAAATCCAACGGAATTGNG
GAGTTATCATGATGAGCTGCCGAGTCAATCGATACAGNCAACTGNCTTTGACCTTTGGTA
CTACTCTCTTTCGAAGATGATGNCGCACTTATTCTATGCTGGCTCAANGGTAGAGGCATN
TTAGTCTNCACTGGAGCCATCTTTTTTTTGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnan


CLOSE