Detailed Information [112701]

Strain Information
DGRC Number 112701
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP1563 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP1563 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site ---
Map Viewer
Related Genes CG40156 CG40158 CG40160
Original Number 1563
Chromosome 2
Comments NP line. Received from the National Institute of Genetics.
Balancer CyUW14
Cluster id 2101
General Information NP_lines
Lethality lethal
Embryonic Expression cns
Larval X-gal epi, mt, dots on gut
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np51145_0227
Strand Minus
Insertion Point 3091508
Chromosome Band U
Flanking Sequence
gggggcccgnnnngtnngttttttggnnnggncccctngggngncaaaaacccntanttt
tanacttncggtaagactncggctatcgacgggnaccaccttatgttatttcatcatgGT
CTATACACACTGGAGTGTGCCACATTGTCATCTCTCTCTAACACACTATTTATGACCACT
Cgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtncgt
tttcaggaagggcaagccatccgacatgtnatnctnttcagaccantcaaatccatgaag
agcatccctgggcataaaatccaacggaattgnggagnnatcatgatgngctgccgagtc
aatcgatacagtcaactgtctttgacctttgttactactctgttncgatgatgatgtcgc
acttattctatgctgnctcaatgttagaggcatatcaagtntccactgaagccaatctat
ctgggatngannantncatanganaganccgnnnncaaagaacccantntngntggggnn
cgnnnnaggangggnnngnnntncnnnntgnnnnnntnnnnnnaccannnnnnnnnnngn
nnngnnnncntggnnntnnnnnnnannggnnnngnggngnnnnnngnngagnngnnnnnn
nnnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnngnnnnn
nnnnnnnnnnnnnnnnnnnnnngnnnnnngnnnnnnnnnnnnnnnngnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnn


CLOSE