Detailed Information [112777]
 

Strain Information
DGRC Number 112777
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP2095 / CyO
Genotype w*; P{w+mW.hs=GawB}NP2095 / CyO
Break points/Insertion Site 35D1; -; 35D2
Map Viewer
Related Genes CG15258 nht esg
Original Number 2095
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2095

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 1199
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression cns, muscle
Larval GFP esg-like
Larval X-gal proximal circle in leg and wing discs,
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np28155_0807
Strand Plus
Insertion Point 15311857
Chromosome Band 2L
Flanking Sequence
antcttggggtgacantncctttatttgtatacttcggtaagccttcggctatcgacggg
accaccttatgttatttcatcatgGCCCGAGAGAGCGTTCTCTTTTGGCAGCTTCGTGTA
ATGAGCCGAGTGCCGAGTGCAGGGGCAGTATAAAAAGGCCGCACCACCGCCAAACTCGCT
CAGTTATTCCCAGACTCTAACCGATTCACATAACCATCTGTCCCAACGCAATATACCCGA
AATATAACCGATATTCAATCGCTTTGCTTAACGGAACACGCGTTTGGTATCTGTGCATCg
atcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttt
tcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagag
catccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaa
tcgatacagtcaactgtctttgaccctttgttactactctcttccgatgatgatgtcgca
cttattctatgctgtctcaatgttagaggcatatcagtctccnctnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nn

Image Files
Disc

d1 (->Large)

d2 (->Large)

d3 (->Large)

CLOSE