Detailed Information [112800]

Strain Information
DGRC Number 112800
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}NP2150 / FM7c
Genotype w* P{w+mW.hs=GawB}NP2150 / FM7c
Break points/Insertion Site 9D3
Map Viewer
Related Genes CG32674 CG32678
Original Number 2150
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP2150

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 263
General Information NP_lines
Embryonic Expression AS, gut
Larval GFP no larva
Larval X-gal sg
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np27555_0807
Strand Minus
Insertion Point 10325748
Chromosome Band X
Flanking Sequence
GTGTTCTTCGGNAGCTTCGGCTTCGACGGGACCCCTTATGTTATTTATCATGGTTCAGTT
CAGTTTAGTTCGAGTTCGCACTCGGCCACAAACGGTCGGTCGGTCGGTCGGTTGTTCGTT
CGTTCGTTCGCTGAAGGAGAATTGTGGAGAAGAAATTGAACCCGTAATCTTCGGAATCCG
TAAAGCCGTAGTCCCGTAGTCGTAAGGCGATCGAAGAATACATAAGAGAGAACCGTCGCC
AAAGAACCCATTATTGNTGGGGTCCGTTTTCAGGAAGGGCAAGCCATNCGACATGTCATT
CTNTTNAGACCAATCAAATTCATGAAGAGCATTCCTGGGCATAAAATCCAACGGAATTGG
GGNGGTATCATGATGAGCTGGCGAGTCAATCGATACAGGCAACTGTGTTTGACCCTTGGT
ACCACNCTCTTNCGAGGAGGAGGTCCCACCTTATTNTATGCTGGCTCAAGGGAGAGGGTN
TTAATCTNCCTGAGCATTTTTTTTTTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNN
NNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE