Detailed Information [112869]

Strain Information
DGRC Number 112869
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Shroom[NP2299] / CyO
Genotype w*; P{w+mW.hs=GawB}ShroomNP2299 / CyO
Break points/Insertion Site 50F4
Map Viewer
Related Genes CG13942 CG8603
Original Number 2299
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2299

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 755
General Information NP_lines
Embryonic Expression sg, pns
Larval GFP sg
Larval X-gal sg, tr
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np22685_0807
Strand Minus
Insertion Point 9396155
Chromosome Band 2R
Flanking Sequence
CANCCTTTGGGGGNAANAAACCCCTTTTTTTGGGGGNNNNNGNAAAGCCNNNGGTTTTGG
NNGGGCCCCCCTTTTNTTTTTTATTCCTGGCCCCAANCGGAAAANGNCCTTAANCNCNCN
TTTTANGAGNGNGCTTCCGTTANGAGANGANAANAANTCGTGGTANGANAANTANTTNTG
TTAAACTNAAAAANGTANCATNNGNTTAACATGCAGTTAACAGCAGCGNGCAGAGCANCT
NGGGAANGAAANCTAANGCNCAGTTTTAAGCGCTGGGCNCTTAACATTGNGCNTTNAGCA
CTGCAGCGCTNAAANGTAGGCANCGATTNGTTNGCNCTGAAAATNCCANGGANCCTTGCA
ANCNCCATAAANGGTAGTTTNATNTTCCTGTTCTCCATNCNCATATGTNTNTATTTNTNT
GANCCACTNTNTANATTTTAGTCGGATTAAACAAGCTTTATTATTATAGGTNCTGGATCG
AANAATNCATAAGAGAGAACCGTCGCCAAAGAACCCATTNTTGTNGGGGTCCGTTTTCAG
GAAGGGCAAGCCATCCGACATGTCATCCTNTTCAGACCAATCAAATCCATGAAGAGCNTC
CCTGGGCATAAAATCCAACGGAATTGNGGAGTTATCATGATGAGCTGCCGAGTCAATCGA
TACAGTCAACTGTCTTTGACCTTGGTTACTACTCTCTTCCGATGATGATGTCGCACTTAT
TCTATGCTGTCTCAATGTTAGAGGCATATCAGTCTCCACTGAGCTTTTTTTTTTGGGGNN
NNNNNNNNNNNNNNNNGNTGngnngngttnnnnnnnnggnggnggnngnggngnggnnng
ngggnnngnnggnnntgnnnnnnnnttttnntnnnnnnntnntttnnnnnnntnttnnnn
nntnnnnnnnntnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
ntnntnnnta


CLOSE