Detailed Information [112906]

Strain Information
DGRC Number 112906
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}numb[NP2384] / CyO
Genotype w*; P{w+mW.hs=GawB}numbNP2384 / CyO
Break points/Insertion Site 30B5
Map Viewer
Related Genes CG3769 numb
Original Number 2384
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2384

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 1129
General Information NP_lines
Embryonic Expression scattered cells (SG), a small # of cells
Larval GFP gut
Larval X-gal gut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np21365_0807
Strand Minus
Insertion Point 9440938
Chromosome Band 2L
Flanking Sequence
atttttgcgtgcactgaatttaantgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgGTTTGAATGGAAATGATTATGGCACTCAAGAGAGTCATC
AAAGAGAGTTACCAAAGACTTAGCTATTAACAAAATGCAAAAGATGGCCAGGTGGTTATG
AAATCCCAACGGACATACAAAGCAAATGAAAAGAATAAAAACTGATTAACTGAACAATAA
TCAAGGCTCGGTAATCAATGTATTGAACTTATCGATTTGAATTAGTTGCCCAACCTAAAT
TCCGTGACAACAATGGCAAAATGATCGATNAATACATANGNGAGAACCGCCNNCCAANAA
CCCATNCTTGGTGGGGGGCGTTTTNANGAAGGGNANGCCATCCGACCTGTCATGCTTNTT
AGANCAATCNAATCCATGNATAGCNTTCCTTGCGCGTAAANCCAACCGACTTGTGGGGGT
ATCATGATGGCTNGCCNGGCAATCGATACAGACAACTGACTTTGACCTTTGTTCTACTTC
TTCCATGAAGAGGGNGACTTANTCTATGCTGGCTNATGTAGAGGCATATCAATCTCCTGC
CGCNNNNNNNNNNNGGNNNNNNNTTTNNNNNNTTNNANNNNNAAAAANAANNGNNNNNNN
NNNNAAAAANNCNCNTNNCCNGAAAAAANNNNNNTTTTTTTNNCCNNNTTNAAAAAAAAA
AATNNCNANTNCCNNAAAGNNNNCNNNNNTTTNNANNTTTNNNGGNNNGGNANNNNTTTN
NAANNNNTTNNNNNNNNNNNcccnnnnnnngnnnnntnnnnannnnnnncnnaaanccnn
nannnnnnnnnnnnnnccnttnnttnnnccccnnnnnnnaaannnnnnaannnnccnttt
ttnnggnnnnannnnnnnanccnnnnnnccnnnnnnnnntttnnaaaannnan


CLOSE