Detailed Information [112950]

Strain Information
DGRC Number 112950
Genotype with FlyBase Link P{w[+mW.hs]=GawB}CG3655[NP2522] w[*] / FM7c
Genotype P{w+mW.hs=GawB}CG3655NP2522 w* / FM7c
Break points/Insertion Site 1E3
Map Viewer
Related Genes EG:BACR42I17.12 EG:103E12.3
Original Number 2522
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP2522

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 26
General Information NP_lines
Embryonic Expression pole cells?
Larval GFP gut
Larval X-gal sg, gut, mt,
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np23755_0807
Strand Minus
Insertion Point 891054
Chromosome Band X
Flanking Sequence
tttttttgtgacttcggtaagcttcggcttcgacgggaccaccttatgttatttcatcat
gGCCATGCGCATATCTTTCTAGGTATGTATGTAAATATGCTGGGCGCCATGAAAAATAAA
TAAAAATGCGGTTGGCATTGCACTTTGCTCGGTCGAGCAACGGCAGGAAAGCTGCCTTTC
GCTCTCGATTCTGCTCGGTTTTATTTTTCTTTATTTAAGACTGTACCAACTACTATTTTA
TTATATTTTATTCTTTCCGCTTGCCGGGGGAACATGAGCACTTAACACGAGACACTAATT
TTTTGGGGAAATATGTAAATACCTCCTCAAGCTTGNTTATTTCGTATTTAACTATATTTT
GGCTTACTCCCACGAAAGTTCCTCGTAGGTCGCAGACGATTAATAAGGAATATTTTTGCT
CTTTAATCAATAGACNAATTCTTTTATTTGGNGGATTAAAAGNNAAAAGGATTTGGCACG
AGTTTTACTCGATTCAATAAAAATAGTTCGATAGACAATTATGCTGNAATATCGATNTTA
GNGAGCTGGCTTGGTTAATGGCGGTNATTGAATTAGCNCCCCCNCTTANGCCACNCATNA
ACACCTTTTTACTTACTGGAAAACACAACTNGGCNGGAGGAACCACCAATTGGATTAANG
CAACCAATCGAATCGCCGAACAGGAAAACCAAAAAANAAAAANGGGTAAAGCTCCAAANG
GGAAAACGNNGGTTTTAATCAAACAAATGCTTAANCCCGCCCAAAAGGCCATCCCTATGC
AAAANGATNTTTTTAATCCNccnggcaaanacaaggccnancncggcaanaaaaancaaa
ggnggnaagggaaatggccnnacccaatnnaaaaacgggccccaaanaagggcccctttt
ttngggccccctcctttnttncnt


CLOSE