Detailed Information [112951]

Strain Information
DGRC Number 112951
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}PRL-1[NP2526] / CyO
Genotype w*; P{w+mW.hs=GawB}PRL-1NP2526 / CyO
Break points/Insertion Site 35F1
Map Viewer
Related Genes BG:DS07473.1 BG:DS07473.2 PRL-1
Original Number 2526
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2526

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 1206
General Information NP_lines
Embryonic Expression sg, a part of brain
Larval GFP pns, gut
Larval X-gal sg, epi, gut, cns
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np23785_0807
Strand Plus
Insertion Point 16229799
Chromosome Band 2L
Flanking Sequence
TNTTTGGGNGTGGCACTGCNATTTTNNTTGGTATTACTTCGGGTAAGGCTTTCNGGCTTT
TCNGANNGGGACCCCCNTTNNGTTTTTTTANTCNNNGGGCCCGTTCCCGTCCCGGCNGTA
NGTNTCCCTTTGCCGGGGAGAACNAAGAGNGAGTCGGGNCNCNCNTTTNTCCANTCGNTC
ACNCAGNGNGCGAAAAAAANTTNTNTTACAGTCTGGNGCTTNTTNAANGCGCTTTAAAAN
GTCTGTNGNGCAAAANCANTAGAGGCAGGAAAAATAGAANCANTTNGCTNGGTTAGTTTT
ACTTTTNTACTGTTGAACATAATTAGCAGAGTTCAANGGNCCATGAANGGGCGAATTTTG
NGCTTACTAAAAATGTTTAAATTTTAAAGCATTTTATTCGTTCTGGTNTAGTAGNGNCAA
TATAAGTAGTTCTGATTNAAAATCACGAGGGTNTTTATTTTAAAATGTTAAATNGTTTAA
TTTTAGAAACTAGACAACAAGTTAGTTNGTATTCTGTTCTTTTTAAATATAGATCGAAGA
ATNCATAAGAGAGAACCGTCGCCAAAGAACCCATTATTGTTGGGGTCCGTTTTCAGGAAG
GGCAAGCCATCCGACATGTCATCCTNTTCAGACCAATCAAATCCATGAAGAGCNTCCCTG
GGCATAAAATCCACCGGAATTGTGGAGTTATCATGATGAGCTGCCCGAGTCAATCGATNC
AGTCAACCTGGCTTTGGNCCCTTTGGTACTCCTCTCTTCCGATGATGATGGCCCNCTTAT
TCTATGCTGTCTCAATGGTAgaggcatatcagtctcctncccnnnntntttttngnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnn


CLOSE