Detailed Information [112967]
Strain Information
DGRC Number 112967
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Vha16[NP2560] / CyO
w*; P{w+mW.hs=GawB}Vha16NP2560 / CyO
Break points/Insertion Site 42C1
Map Viewer
Related Genes Trap1 Vha16 invader1{}757
Original Number 2560
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP2560

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 536
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression a small # of cells
Larval GFP tr (weak)
Larval X-gal fb
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Library & Clone Information
Library Name / Clone Name np / np23055_0807
Strand Plus
Insertion Point 1692719
Chromosome Band 2R
Flanking Sequence
TTTTGGNNNNATNANCGTNTGTNAATNAACCCCTTTTTTGGGGCNNNNAAAAAACCCNCG
GCTTTTGACGGGACCCCTTTTTTTNTTTNATCATGGCCCACACNNTCATCCCCGCNTTTC
CTCTTCTTCTTCTACCNTTTACGCCACACAAATGTTCGATTTTTCACAGCACGGGCATGG
CATCCTTATTCTAGTCAGATTTAAACTTACCCGAGAAGATGATGGCGGAGGCGGTTTNCA
TAACTCCGAAGAAGGGGCCATAGATGGGGTTGTCGCTGCTCACTTCAGAAGACATTTTGC
TTTGTTTGTTGTGTGTTTTTTAGGCTACAAATGATGAGAAATCGAAATTTTAGTTCGTTT
TGCTGCTGCTGTGGTGATTGCACTATAGTTTTTATTCGGCGTTTTGCACAGATGAATCTG
AATGTTATGCGCGCTCGTTATATGTATGCGTTGCTTCAAGTCGAAACAAAGTATTTTTAT
TATATGTACAATATATGTGCTATATACGTGGGGTTTTACGCTGCTCTGCGACCAATGCTG
CTGCGACGACGAACGAATTGCGAGTGGCCGCTCACGGAATATTCTTAAATATACTTTTTA
ATCGAGAGTTGGCAAGTCGGAGCGAGTGGCCAACAACGAAAACTGGGAGAGAGCAGCAAG
AGAGAGTGAGATTGAGCGAGAGGCCACTCGTCGGATTATTGCGCTTGTGTGGAGTGTGAC
CTGTGTGCATGTGCATGTTGTCATGTGCTTGTGTGCCCCCCGAGAGTGAGCNCATGACAG
GCNCACATCACGGGATAGTAagtncaattggcaatgaccaccgggctggaaaatacncac
gtncccacaatcacatggggagctgttaaaacctgggtttcaggcttttgcaaaangnaa
aagcaatttttgcnctttntganangcctgggcctcctggttnattcccatggttnaacc
ncaaacttncctcccaaggaattnntgtcatggctang

CLOSE