Detailed Information [113052]

Strain Information
DGRC Number 113052
Genotype with FlyBase Link P{w[+mW.hs]=GawB}NP2815 w[*] / FM7c
Genotype P{w+mW.hs=GawB}NP2815 w* / FM7c
Break points/Insertion Site 2F5
Map Viewer
Related Genes EG:25E8.4 Tirant{}24
Original Number 2815
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP2815

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 69
General Information NP_lines
Embryonic Expression epi, AS
Larval GFP gut
Larval X-gal gut, mt, ch
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np15785_0727
Strand Plus
Insertion Point 2057815
Chromosome Band X
Flanking Sequence
CNCGTTGGGTGCNCTGNNCTTATTTGNAATACTTCGGTAAGCTTCGGCTATCGACGGGAC
CCCTTATGTNTTTATATGGCACAGTCNTCCGAAGAGAGACCGANAGAGAGTGCANGCGAG
AGAGANCGCGAGTCAGTATGTATTTGTATTTGTTTTGCGAAGGGCTCTGCTCATGGGCGT
AGCAATAGGGGCGGGAGGGGGAATGGACTGTNTTTAATCGGCAGGTTGCGGCTTTGTNGA
GGGNNACCATTCAAAAGGCCTGTGCTTATCAAGTCGCCNCTACCAACTCCTCAATTNTGT
GGATTTGGTCGGCATAAAAAGTGGTAACCACCGNCCCCATCTTCATTTCTCCCATTTCCT
TGNGANCATTCAGCNGGCTNCTTCATTGTCANACTTTTCTGCATATTTCTATNNCAACGT
TNATGGATTTTNATTTCAGGGGAAGGCGNATACATATCAACATGCCTGCTGTGGTGGTAN
TTAGTNGNCGGGTAGACCGGCNGCGNNGANAAGGAGAGCGGNGAATTGGCAAANNNGAGC
AGNAGTNGATGTGNATTTTTNAGNTGAAGGGGNGNGGCCNANTGNCGTNCAACCTCCGGC
AGCNATCCCCTTTNACNNGNCAANGGTNNTAAGNCTGCATGGGGCNCCCCCCTTTTAAAC
GCCNTCTCCNTTTCTTTCNNNNCGTNCNANTNTTAANTCTTANTTCTNNCNTTTANTNNA
TTTTTGGCCNNNCCCNNNNCCCNCTCTCCCCCNTTTATATTAANTANTAAANNNGCNNNA
NNAANNNNCGCCNACNCANTtannncccnaccctnntnntntcctnnntttgtgncaaat
aacnccntnnannntgtggnnngccanattangcgcncgcgcnttttnncgncaaannng
tttggtncncanttcnnncncancngttccccnnnngantnntcannnnnattnat

Image Files
Disc

d1 (->Large)


CLOSE