Detailed Information [113068]
 

Strain Information
DGRC Number 113068
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP3027
Genotype w*; P{w+mW.hs=GawB}NP3027
Original Number 3027
Chromosome 3
Comments NP line. Received from the National Institute of Genetics.
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression a small# of cells
Larval GFP sg
Larval X-gal cns
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np34065_0907
Flanking Sequence
ttnanngtgcactgantttaantgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgGTCCGACTCTAGCGTGCCCCCgatcgaagaatacataagag
agaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatc
cgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatc
caacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtct
ttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctcaa
tgttagaggcatatcagtctccactgaagccatcttattctggagngntntntngngatg
angatgncnnaacttattctatgctgnataaagntagaggcntatnanactncactgacn
ccnnttttnntgnnnnnccncnnncnntntnnnnnngnnnnannnccntnntnngntngn
nnannnnnnannnnnnnnnnnnnnnannnnnnnnnnnnnnntnnnnnnnnnntaaccnan
nnattnnnnnttnnnnnaantnnnnntnnnnnncngcncnnngnnnnnntnnncnttcnn
tnnnnnnnnnnnnnnnnnnntnnnnnnnannccccnnnnnnnnnnncnnnnctcttnnna
aanntnnnnnnnnngnnnnnnccnnnnnnnttnnntcnnncnnnnncnnnncncnnnnnn
nnnnnnnnnctntntncnnnnnnnnnnnnnnnnncccnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnncnnnncnnnnnnccncncnnn

Library Name / Clone Name np / np63233_0309
Flanking Sequence
gngnggnggggnngcngggggngggnggttntgttttttgggnngnttaaactgnnggtc
ataancncagttttnnggtaagtggaagtcccttgccgacgggnaccaccttatgttatt
tcatcatgAGTCGGACGGAATGATGNCGTGGNAGNATCCCGNCGGGGCNCGGGGCNCCGG
CCNATNGAGGGGGNCNCCNANCTTNNNNGNNNNGGGGGNNNNNNNNNNNNNGGGGGNNNN
ANANNNNNNNNCNNTNNNNNNTNNNNNNGNNNNNNNCTTTNNNNGGNNNNGGGAGGNNNC
NTNNNNNNNNNNNNGGCGGNNACCTNNNGGNNNNNAAANNTNNNNNNTTNNNNNnannnn
nnnnnnnnnnnnctttttnaaaaaaaaaaannnnnnngnnnnnaaannnaaantttttnn
gggggtttttnttttnaaanncnncnnnngggnnnnnggggggggggggggggnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnn

CLOSE