Detailed Information [113070]

Strain Information
DGRC Number 113070
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP3032
Genotype y* w*; P{w+mW.hs=GawB}NP3032
Break points/Insertion Site ---
Map Viewer
Related Genes CG40260 CG40315
Original Number 3032
Chromosome 2
Comments NP line. Received from the National Institute of Genetics.
Cluster id 2061
General Information NP_lines
Embryonic Expression sg
Larval GFP heart, gut
Larval X-gal epi, gut
Adult GFP mouth, ant.
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np34115_0907
Strand Minus
Insertion Point 671105
Chromosome Band U
Flanking Sequence
gttntttttnnnngnatnttcttggggtgncactganctttttttgtatacttncggtaa
gcttcggctatcgacgggaccaccttatgttatttcatcatgGGCTATACACACTGACGT
GTGCCACATTGTCATCTCTCTCTAACACACTATTTATGACCACTCgatcgaagaatacat
aagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaaggncnng
ccatccgacatgtcatcctnttcagaccaatcaaatccatgaagagcatccctgggcata
aaatccaacggaattgtggagttatcatgatgagctgccgtagtcaatcgatacagtcaa
ctgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatgctg
tctcaatgttagaggcatatcagtctccactgaagccattnatatcggnnnnnnnntnca
tatnaaaanctnnaactnttnncatttnnccatgacttgattnntnataataacattggc
gtgnctctctnanncccaatntntgaccccnncataacactnntngnncctngnnagnna
nntgnnatagngcannnntannactngacccccgncataacactnnnngnncntgngagn
nanntgnnnnngngnnnnnntnatnnntngnccccnnncatacactnnnnnnncctgnnn
gnnnnntgnnntnnngnnnnnnnnannantngcccccnnnntaacantnnnnnnncntnn
nannnnnnnnnnnnnngnnnnncncnccnntnnntnntannnnnnnnaangnnnnnttnn
tggnncnnnnnnnncnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np63243_0309
Strand Plus
Insertion Point 671098
Chromosome Band U
Flanking Sequence
ancttnggcgcactaanccgcaagtttacgttaagtggatgtctcttgccgacgggacca
ccttatgttatttcatcatgGTATAGCCATTAGAGAATATGATGAAGAAGGGACATGTAA
GAAGATCCNCNGNCGGNCGCNTAGGCCACTNGCGGATNATGGATACTCTANCTNNAGCTN
TGCGTNCTCNCAAATTATNTAAAANGTAACTTTAAAAACCCNTTTTTTTNNTNAAGGNTA
TNAGNNAANNNAAACCCCCCGNGCNNNNNNAAGGGNAAANAANACNNANATNTCNGTGTC
TCNCTCACNCNCNANGNGNCNNNAAANGTANNNTNCNTTTCNCTCGCNCTNNGNNNNNNC
ANNCNNNAAGGGNNTGTNTTTTGCCCACGNNNCCACTTTTATGNNATGGGNACATGGTAT
AACCNTNAGAGANTGTNNNNAAGNGGGCNCGTGNAANAAGANCCTCGGGCNNGNGCTTGG
NCCNCTCGGGAATTAGNAANNATANAGCTNGANNNNCCCCNCCCCCCANTTTATTNNAAG
NGNAANTTNAAACCCCCCGGCCNTGNTAAGGGTTAGNNANCAATATANCNCTGNGGCNTT
TCAAACNGNNTAGCNCANCNANNGTTNTNTTNNTTNANTCTNNCCNNAGNGACACCAAAC
GTNAAGNNNANTNNNNTTGCCCNNNGNNNCCNCCNNANNGTNANTNNNNNNNNCNNACCC
NNNCGNCCANTTNNNNNNANNNCCCCCNNNNNNNANNNCNNNNNNCNNNNCNNNNNNNNN
CCNNNNNNNNNANNNNNCCNnnncnnnnnnnnnncnnncnnnnnnnnnnnnnnannnnnn
nnnnnnanncnccnnnnncncnnnnnnnnntnnnnnnnnnnnnnnnnacnnnnnnnnntn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
annnnnnnnnnnnnnnnnnncnnnnnnnnnnnnncnnnnnnnnatn


CLOSE