Detailed Information [113084]
 

Strain Information
DGRC Number 113084
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP3064
Genotype y* w*; P{w+mW.hs=GawB}NP3064
Original Number 3064
Chromosome 2
Comments NP line. Received from the National Institute of Genetics.
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression weak
Larval GFP sg
Larval X-gal sg
Adult GFP head
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Schmid MR, Anderl I, Vesala L, Vanha-aho LM, Deng XJ, Ramet M, Hultmark D.
Control of Drosophila blood cell activation via Toll signaling in the fat body.
PLoS ONE (2014) 9(8) e102568 [PubMed ID = 25102059] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np34615_0907
Flanking Sequence
TTTTTTTTTTGNGGTGNCACTGNACTTTTAAATTTGNTNNTTNNNNNNNNACCCCTTTNN
NTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNTNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTNTTTNTNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTNTTGCGGNACGGG
GGNACCCACCCTTTTTAGGTTTTTTNTTTTTTTTTNNCCNATTNCCATGGGGGTTTCCAA
GGGGGAAACTTCCAACCCANGCCGGCTTCGGGCTTTCTTCGGTGGTTTTTTCNGGGGCCC
CCCGTTCAAGCNAAGCCGAACTTCGGGGGNCCTTGTCTAAGGAAACATGGTTTTGGGGGT
NTTGNGNTGCCATTCCGGGAAACAAAGGGGGCCCCGTTTGGGTTCCNCNNCTTNCAANGG
GTGGNGGGGGGNNCAACCNGGGGGGGNAAAGNNGGTTNTTTTNAAAAAACCAACCCGGGG
GGCGGGGGAAAAAAAAAAGGCCCCCNAATTTTTTTTTAAAANCGGGGANCNNNTTTNAAA
AGGGGAACCCCCCTTTTTTGNGCAAAATTTTTTTGAANANTTTNNNTTTTTTTTNAGNAA
AAAACCCCCGNCTNTCNCAAAAAAAAAAAAACCCCCTTTTTTTTTTNTTTTTGGGGGNCC
CNCCCTTTTTTTTTNNNANGggggggggggggngnncccccccccncccccannnggggg
gnctnncnnttttnaanccccnccnccnccntnntnncnctttnctggnnnagnnnnnnc
nnctnntnngcgnggggtttaattnanaaaattanccccccccnnntnttttttntgggg
ntntttnttntntant

Library Name / Clone Name np / np63353_0309
Flanking Sequence
anctttgngcgcacttatcgcaagtntacgttaagtggatgtctcttgccgacgggacna
ccttatgttatttcatcatgGTCCTGACGAAGATCCGCGGCCGGCCGCATAGGCCACTAG
TGGATCTGGATCCTCTAGCTAGAGCTTTGCGTACTCGNAAATTATTAAAAATAAAACTTT
AAAAANAATTNCGTCTAATTAATATTATGAGTTAATTCAAACNTTNCGGACATGCTAAGG
GTTAATNAACAANCATATCNNTGTCTCACTCTNACTCNNACNNAATANNGCAAGTAANAN
NNCNATTNCTTNNCACTTATTGTNATGCGNACNNATAAGGGNATGNNAATTTANCNNNNG
CAACCANNNNTACGNNNANNNNAATNNTNNANNNNAANTNNNNATANNNNNNCNNNNANC
NTANGNNTNNNNNNNNANTNTNNANNNNNNANNNNNNNTNTTTTTTNGGNNNNNNNNANN
NNNNNNTNNNNNNNNTTTNNNANNNNCNNNNNNNNNNNNANTNNNNNNNNNNNNNNNNNN
NNNANNNNNNNNNNNNNNNNNTNNNNNNNCNNNNNNNTTNNNNNNNNNNNNNNNNTNNNN
NNNTTNNNNNNNNNNTTNNTTATNNNNTNNNATTNANNNNNNNNNNNCNNNNNNNTNTNT
TTTNNTNTTTNNNNNNNNNNNATANTANNNNNNNNTNNNNNNNNNNNNTATNNNNNNNNN
NNNNNNANNNNNNNTTNNTNNNNNCNNTNNNNNNNNNNNNNNNNNTNNTTNTTNNNNNnn
nnnttnnnnntntnannnnnnnnnnannnnannnntntnntnnnnannnannnnnnnnnn
nnnnnnantnnnnnnnnnnntnnnnnnnnnnnnnnnnatnnnnnnnnnnntnnnnnnnnn
nnnntnnnnntnnnnnnaannnnnnnnantnnnnnnnnnnatnnnannnnnnnnnnnnnn
annnnanntnntntnnttnnntnatntanaannnnnnntnant

CLOSE