Detailed Information [113086]
 

Strain Information
DGRC Number 113086
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP3069
Genotype y* w*; P{w+mW.hs=GawB}NP3069
Break points/Insertion Site 35D1; -; 35D2
Map Viewer
Related Genes CG15258 nht esg
Original Number 3069
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3069

NP line. Received from the National Institute of Genetics.

Cluster id 1199
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression esg like neuroectoderm expression. later pattern not confirmed.
Larval GFP esg like. wg, leg (stalk), hb, genital, DT node. weaker than other esg-like.
Larval X-gal proximal circle and center in leg, gut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np34645_0907
Strand Minus
Insertion Point 15310921
Chromosome Band 2L
Flanking Sequence
catcttttngggggaaaaaaaacccccntttttnggggctncggtaagactcccggctat
cgacgggaccaccttatgttatttcatcatgAGCCAAGCTAAAATTCAGTACGAAAAAGA
GCATAAGCATTNTTTTTAAGCCAATTGCTTCTCTTCACTCTCACTGTTTCGATTCCACTT
TGTTTCTGTTTCGCTCTCGAAATTTTCTCTTCGATTTGAAAAACGTTTNNNGCGCCAAAG
CCACTAAAGGCTGAATTGNACCTTTTTGACAAAACGGAGAGAGANATTTAGGTTCTGGTT
TTTTTTTTTTTAAGGGGGAAACCCTNGGNTNNNTNTTTACAAAACCAAAAAAGGGGGGGG
GGGGCCCNCCCCTTTNTTTAAAATTTGNTNCCCAAAAAAAAAANAAATTTTTTTAANAAA
AAANACATTTTTGGGGGTCCNANAANACCANNNNGNNAAAACCCNNNGCCNAAAAAACCC
ANNNTTTGGNGGGGGCCCCNCTTTNNCNGGGGGGGGNGNNNGCCCNNCCCCANTGGTTTN
TNNTTTTTNGCNCCCCAAAAAANTNNNTGGGGGGGNGCNCCCCCGGGGNCTNAAAAAANC
CCCNCCGGGNGGNGGGGGGGGGGTTNTNANGGGGGGGGGNGGCCGGGGGGNAAAANNTNC
CCCNCGCCCCNNGGGTTTNNGNCCNCNGGNANCNNCCNCNCNTNCCCCAGGGGGGGGGGG
GNCCCNCCNTTANNTTCNNGGGGNCCNAAGGGGGGGNNGGGGNANNAANNNCCCCNCNNG
ANNNCCCCCTNTTTNNNGNGnngccnncnnnnncnnnnnnngncnncnncncnccntnnc
nnnccccnnncnncnnnntnntncnnnnnnnnnccgccntnnccnnnncnncncnnnncn
tcgnccgncncncnnnnnnnnnnnnccnnnnncnnnnnnggnnnnnntnncncnnnnnnc
ncngcnncnnnnnnnnnccnccnncann

Image Files
Disc

d1 (->Large)

d2 (->Large)

CLOSE