Detailed Information [113118]

Strain Information
DGRC Number 113118
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP3134 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP3134 / FM7c
Break points/Insertion Site 8F9
Map Viewer
Related Genes btd CG15321
Original Number 3134
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP3134

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 249
General Information NP_lines
Embryonic Expression weak muscle
Larval GFP gut
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np35205_0907
Strand Minus
Insertion Point 9424871
Chromosome Band X
Flanking Sequence
gttttttttgnnnngnacnancgtnnggnttnaaccccttttttggggcnnncnttaaag
nccccggctatcgacgggaccaccttttgttatttcatcatgGCCTGGNNTGAGCGGTCT
CGCCGACGCAGAGAGCGAGGGACTAGAGCAAAACAGTGTTCCGACAGCGGTTAACAGCTG
TTACGGGGCCAACAGACTGCTAGCAAAGGCATTTATATGGATTTCGGGTCGTAACANTNC
GACAACAGCGGCCAAACAGCACGCGAGAGCGACGAGAGCCCACTCGCGTGTTGTGTTAAA
CAGTCAATTTTAGTGTATTTCCGAGCTCGGTGGTGTATTTGAACGGCTAGCCGCGGTCAC
ACTGAAGCAAAAACATTTTTGGCTCGGAGAACGATTAACACAAGCGGACTGAAATTTTTT
TGTTTTAGTGTTGCGAAAAAGTTTGTGGGATTTTTATAAAATCGCCGGAAAATGTGAAAA
ATATATGGTATAAAACCGAAATTCGGCAAAATTGCAAGTATAGTTAGAAATTTAGTGCGT
GGCAATCGGTGACGGTGGAAAAATAAAAAATACCGGCCAAAATNGGGCTGAAATTTTTTT
CAAATTTTTCTACGGCATTTTTCTTGAATTTTCGNATTTTCCGCCAAATATTTTTNGCGA
ATTTTTGTGGGAGGCCCGGGAAAAAATGCAAAAACGCCTCTTGGCNGGAANACAACACCA
AAAAAATTTCCTGNCAATTAGAAACTTTTGCAACCGACCGNTGANGNAAGAAAACCNAAA
CCGAAAACCCCNNTAACNAAccccngaaaaaaaaaangggaantatntttcntgggcgcg
ctngttttttctttttttttttnccaatgctnccttcncactcggttggccgttttaccc
ntngngnngnttttattgnnncacntnattgccccctttgggcactaanaaccnttggna
tngcctt


CLOSE