Detailed Information [113143]

Strain Information
DGRC Number 113143
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}CG9328[NP3181] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}CG9328NP3181 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 38E8; -; 38E9
Map Viewer
Related Genes CG9326 CG9328
Original Number 3181
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3181

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1272
General Information NP_lines
Lethality semi lethal
Embryonic Expression restain,
Larval GFP gut, epi
Larval X-gal epi
Adult GFP all PNS
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np35535_0907
Flanking Sequence
GNGGGCCNGGNNGTGNTNNGTTTTTTTTGGNNGGANTNAACNGGGGGGGCATAAAACCCT
TTTTTTNGACTTNCGGTAAGACTNCGGCTATCGACGGGNACCACCTTTATGTTATTTCAT
CATGATCGAAGAATACATAAGAGAGAACCGTCGCCAAAGAACCCATTATTGTTGGGGTCC
GTTTTCAGGAAGGGCAAGCCATCCGACATGTCATCCTCTTCAGACCAATCAAATCCATGA
AGAGCATCCCTGGGCATAAAATCCAACGGAATTGTGGAGTTATCATGANGAGCTGCCGAG
TCAATCGATACAGTCAACTGTCTTTGACCTTNGTTACTACTCTCTTCCGATGATGATGTC
GCACTTATTCTATGCTGTCTCAATGTTAGAGGCATATCAGTCTCCACTGAAGCCATCTTA
TTNTGGNNNNNNNNNNNTNNNNNNAANNNNNNNNNGNCCNNNNNNNNTGNNNGNNANAAN
NNCNNNNANNNNNNNNNNNNNNNAAANNGNNNNNCNAANNNNNNNNNNNNNNNNNNNNNN
NNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAANNNNNNNNNNTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnncncnnnnnnncnnnngnnnnn
nncccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np63493_0309
Strand Minus
Insertion Point 20767547
Chromosome Band 2L
Flanking Sequence
nttttnctncgcacttattgcaagtcatacgttaagtggatgtctcttgccgacgggacc
accttatgttatttcatcatgGCTGAGATGTTATTCCACAGTGGTATTTAATTTGTTTTT
ACTCTTCATGCGAGGAAAGCACCGTACGCGCACGCTGCTCAAAACGGAATGAAAACAAGA
GCTGTCGCATCGTTTCAGCCGAAAAATACCGAAGCATGCTGAAACTTCGAAAAATACCGC
AAGCGAGAAACGATGTTTTTTCATCTATGGCAAGTCGACGTCTATTACCCTTTCGATTAA
TAGAAATAAAATATTGCATATTTATTGAAGTAACGAAGTTTGTTGCATCCCAGAGTTTTG
TTAAGGCATAAATAAAGTTCCATAAGCAATTTAAAGACTATTTAATTAAATTGATTTCTA
ATTGTCATATGAACGAACATTTATTGGTCGTCCAGTTTAGAGTACATATTTATGTACAAA
TCGAAGTAAATTTTTCATAATATTAACGCACGGTTTATCAATGGCACAAACCACAGCGAT
TCCCAAGCCATCCATTTTTAGCTATGTTATAGCTATAGAAAAAGCAATCACAAGCAAAAG
TAAAGATAATAAACAATATTAAATTTAAATGGCCTGAGAACAGTGGAATGCATTTTTATG
ACAGGCTTTCGAACTCCGTACATAAAGTACATTTAATGTTATTTATAAAAACTAATGTAT
TACAAAACTTAANGTAAGAAACCGACCTACCAAAGAAGTGGCGCCGATAAGCNCAATATT
TAAAAACCGAAGGCNCACGTtatttgacttttgtctgcaaagctttnttgtttaangagc
tttgattttgggatanctgcacaaagcggntttagnttagtggccnttttcaaacaaatn
ggtgtttttgngctgtngggggngaaatnttancncnctntttttttttgtt


CLOSE