Detailed Information [113221]
 

Strain Information
DGRC Number 113221
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP3325 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP3325 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 35D1; -; 35D2
Map Viewer
Related Genes CG15258 nht esg
Original Number 3325
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3325

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1199
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression tracheal tip!!! expressed in many tr cells in stg 11. then decays. reexpressed in tip cells from stg 13. Also in madial and lateral neuroectoderm + neuroblast in stg 10 (not checked earlier).
Larval GFP tr fusion cells in L2. asp, psp.
Larval X-gal esg? proximal ring in leg, ring in AII of antenna,
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np36785_0907
Strand Minus
Insertion Point 15311691
Chromosome Band 2L
Flanking Sequence
ntcaaacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgGTGTGGGCCATATATTCAAATATGTTTACCTGTGTGCGTC
GTGCTCTCCGCAGCTGCTCTCTCTCGTCCTCTCTGCATTTGCATTCAATGCGCAATAAGG
AGAGCTATgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttgg
ggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatc
catgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctg
ccgagtcaatcgatacagncaactgtctttgacctttgttactactctcttccgatgatg
atgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgaagcca
tctttttattnggannnannnnnnnnncnnnnnnnnannnnnnnnnnnnnnnnnangntn
nnnnaaatnttnnangcnnnnnnnnnnnnnnnnnnantnnannnnnnntnnnnnnnnnnn
nannnnnnnnnnnnnnnnnnnnnnnnnnnnannnnnnnnnnnnnanncnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

d2 (->Large)

d3 (->Large)

d4 (->Large)
Embryo

e1 (->Large)

e10 (->Large)

e11 (->Large)

e2 (->Large)

e3 (->Large)

e4 (->Large)

e5 (->Large)

e6 (->Large)

e7 (->Large)

e8 (->Large)

e9 (->Large)

CLOSE