Detailed Information [113224]
 

Strain Information
DGRC Number 113224
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP3329
Genotype w*; P{w+mW.hs=GawB}NP3329
Break points/Insertion Site 61C8
Map Viewer
Related Genes CG13894 CG13895 CG3279
Original Number 3329
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP3329

NP line. Received from the National Institute of Genetics.

Cluster id 1731
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression weak cns
Larval GFP cns
Larval X-gal ch, posteriot to MF, tr
Adult GFP internal thorax
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np36825_0907
Strand Minus
Insertion Point 680537
Chromosome Band 3L
Flanking Sequence
gcttttttgggngtnctcaatttttttgtatacttcggtaagcttcggctatcgacggga
ccaccttatgttatttcatcatgGGTAGGACGAGATGACAGGTTGGGCTTCGGATTGAGA
TTCCGATTCGGATACGGGTTCGGCTGTTGGGTTCGGGCTGGATTTAGAGTTCGGGTCTTC
GGGCATATATCGCCGACGGCAGACGGACTAGACGCCCNANAACTGACACCACCCCCGTTC
AGTCTGGCGATTCCACGTTCAGTCGCCTGGTATTTGCTACTTTTGTTGTTGTCGCTCTGC
TTGCTGTTTGTTTTTCACGTCTTGCGCCAACGCCAGCGTCGACTGCGGCGCCCCTTGCGG
AGCAGAGCTGATTGTCTGGCTATTTTCTGGCTATCAATTACAAGCCAGGTACAAATTCTC
AATGGAAAATGTTTCCAGAAAGTATGCTATTATTTATTATTATTTCTGCTATCAAACGAA
AATATGTATGATTGCTACTGNAAGATTAATTTGNGGCATTAAATTTTAGTATAAAGTNCA
AACAATTATTAGAGATCGAAGNAATCCANTNAGGAGAGNACCGTCNGCCCAAAGAACCCC
ATTATTTGGTTGGNGGTCNCGTTTTTTCAGGGATGGGCCAAGCCCNTTCCCACCATGTNA
TTCCCTTNTTNCAGACCCAATTCNAAATTGCCATGGAAAGNGCCNTTCCCCNGGNCCTTA
ANNAATTCCAACGGGNANNTTGNTGGAAGNTNTTTCCATGGANGAAGCCTTGCCCGAGGT
CAATNCNGNTTCCAGNCCNAacttggtttttgnaccctttnggtacctncctcntntttt
ccganaganggagggtnnccnnnttnnttntatgcttggttaaattggtctgnnngccat
anttatntnttccnntggaaaccaaatntttcttggtgtgngggngngncnngntgtnna
ntatntntccccnccccccnnnttctnntngccctntccnntctngtngntaggtngatc
ttttnttctcccaantnntctnnnacncgnttnnattantnaanannaaaaaaaaaaan

CLOSE