Detailed Information [113230]

Strain Information
DGRC Number 113230
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}IP3K1[NP3343] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}IP3K1NP3343 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 30C9
Map Viewer
Related Genes CG18854 CG4026 CG4110
Original Number 3343
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3343

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1137
General Information NP_lines
Lethality lethal
Embryonic Expression muscle
Larval GFP ubiquitous
Larval X-gal gut, mt, epi
Adult GFP distal+PNS
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np63893_0309
Strand Minus
Insertion Point 9774644
Chromosome Band 2L
Flanking Sequence
tttnctcgcacttattgcaagctacgttaagtggatgtctcttgccgacgggaccacctt
atgttatttcatcatgGTCTAGCGGCTCTGGATGGCGACTAACTGGTTTCGCCATATGGC
AGCCAGTTTTGTGATCCNCNNCCNGGCGCNTAGGCCACTAGCGGATCTGGATNCTNTANC
TAGAGCTNTGNNTACTCNCAANTTATNAAAAANAAAACTTTAAAAANNATTNCGCACTAC
TTAAGATTATGAGTNAATTCAAACCCNACGGNCATGCTANGGGTTAATCAACAANCATAT
CGNTGTCTTACTCTNACACTAANCGNNANNCAAAGTACNATGNNTTTCACTTGCACCTTA
NTGCCANCATACNTTAAGTGAATGTGTNTTGNCGNCNGNNCCACNNNACGATATGGATCA
TGNTNTAGCGGCNNTGGATGGGNACNAACTGNTTTCGCCATATGGCANCCAGTTTTGNGA
TCCNCTANCTNNAGCNTTGGCNACTNNNNNNTNTNNAAACTNNAACTTTAAANTNNNNNC
NNNNNNTNNNNTAANNANAAATTAAACCNANNCCNTNNANGGNNANNNNAANNNAANNNA
NNNNTTNNNNNNNNNNANAAAAANANNNNNNNNNTTNNNNNNNNNNNNNNNNNANNNNNN
NNNNNNNNNNNNNNNCNNNCNNNNNNNANNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnatnncnnnn
nnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnncnnnnnnnn

Library Name / Clone Name np / np36955_0907
Flanking Sequence
aaatttttnntagggaaaagccctttttttgtatacttncggtaagcttcggctatcgac
gggaccaccttatgttatttcatcatgCGCTAGACCACGTAACGCCACGATTTTCGCCGg
atcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttt
tcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagag
catccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaa
tcgatacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcac
ttattctatgctgtctcaatgttangaggcatatcagtctccactgaagccaatcttatc
tgnnnnnnnnnnnttnnnnnnnnnnnnnnnngctntnncnntncnntcntnnntgttnnn
ngnnntntnnnnnnttnnctnnntncnntcctnnntnnnnnntnnttnnctttntnnnnn
nnnnnnnnnnttttnnttnncntttntnntttnttntnnttntntnnttttnttnntnnn
nntnntntnnnnntnnnnctcnnntttctnnnnnnnnnnnnntnnnnntcnntntctnnn
nnttnnntnntnnnngnnncntnnncnnncnnncntnntnnnttnnnntnnnnnnnttnn
nttncnncgnncnngtncnnnnnncnccnnntcntntncnttntnnctgnncnncntntt
nctnnnnnntttgnnnnncngtntntctnncnnnttnttntnnnnnnngnntnnncgcnn
nnnnnnnncnnnnntnnnnnatttnttttnnntcnnnncntntnnnnnntnnnnccnnnn
nttttnttnttttcccnccccnnnttcgntccttctttctccntctntnccntntntttn
nnnctcttnttccccntncaannananaanaaaaaaat


CLOSE