Detailed Information [113237]
 

Strain Information
DGRC Number 113237
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP3355
Genotype w*; P{w+mW.hs=GawB}NP3355
Break points/Insertion Site 35D1; -; 35D2
Map Viewer
Related Genes CG15258 nht esg
Original Number 3355
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3355

NP line. Received from the National Institute of Genetics.

Cluster id 1199
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression sg
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np11035_0727
Flanking Sequence
actanctngngggaaaaaacccccccnttttgggactncggaaagncntcggctatcgac
gggcaccaccttatgttatttcatcatgGATCGCATGNTACATAAGNGANAANCGTCGAC
ACAATAACCCACACTCGGCTGNGANAGNGTTCGCACNGNAGGNNGAGCAATCNNNCAAGG
NGCCCAACTCAGTACCCTTGCACCACATNAAAGAGCNNAACACTNGGCAGATNNTTTTTN
TGTTAAGCTGCNAGAGGTNGNNCGAATGATGCCAAACAAGTCATACCNGTGCAGCGAANT
GCTCTCNACACTGTGNTACNACTCNNTCTCCGNTGATGATGCATGCACTGNTCATANGNG
GGAGCAATGATCGAGGCAATACAANNCANCAANGNAGCCAATNTAAAAACGCATTATNGN
GGGGGNCCGNTCNCAGGAAGGGCAAGCCATCCGACATGTCATCCTCTNCAGACCAATCAA
ATCCATGAAGAGCATCCCTGGGCATAAAATCCAACGGAATTGNGGAGTTATCATGATGAG
CTGCCGAGTCAATCGATACAGNCAACTGNCTTTGACCTTTGNNACTACTCTCTTCCGATG
ATGANGNCGCACTTATTCTATGCTGNCTCAATGNNAGAGGCATATCAGNCTCCACTGAGC
ATNNNNNNNNGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNANNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannnnnnnnnnnan

Library Name / Clone Name np / np56263_0309
Strand Plus
Insertion Point 15311777
Chromosome Band 2L
Flanking Sequence
TATTGAAGCTTCGTNAGTGGATGTCTCTTGCCGACGGGACCCCTTATGTTATTTATCATG
NNGCGTACTCTNGGCGGAACGCCCGNGAGAGCGTNCTNTTTTGGCAGCTNCGTGTAATGA
GCCGAGTGCCGAGTGCAGGGGCAGTATAAAAAGGCCGCACCACCGCCAAACTCGCTCAGT
TATTCCCAGACTCTAACCGATTCACATAACCATCTCTCCCAACGCAATATACCCGAAATA
TAACCGATATTCAATCGCTTTGCTTAACGGAACACGCGTTTGGTATCTGTGCATCGATCC
TCNNGCNNNNGGCNTNGGCCACTAGTGGATCTGGATCCTCTAGCTAGAGCCTTTGGNTGN
NNNTANNTGAGAAANNGACACTNTTNANTANTGNCNGNGNTGGNAAGNGNTATTNGNGAN
NNCCTGGNTGNNNNNCTNNGNACNACGNGNNCCCCNTANGNGGCNGNNNNNCNNNNNNNN
TTTTTNGGGGGGGNNNNNNNAAAANCCCCCCNNNNTNTTTTNNNNGGNNNNNNNNNNNNN
NGNAAANNGCCCNNNNNNNNNGNNNNNNNNNNNNNNNNANNNNNNNNNNNTNCNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnn

CLOSE