Detailed Information [113244]

Strain Information
DGRC Number 113244
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}tor[NP3370]
Genotype w*; P{w+mW.hs=GawB}torNP3370
Break points/Insertion Site 43E12
Map Viewer
Related Genes tor CG1941
Original Number 3370
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3370

y[*] seems to be fixed. 06Aug2010 M.T.

NP line. Received from the National Institute of Genetics.

Also known as torso Gal4
Cluster id 575
General Information NP_lines
Embryonic Expression sg
Larval GFP tr
Larval X-gal oenocyte
Adult GFP distal leg, ant, mouth, lab. and stripe of internal cells.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2017-03-02
Research papers using this strain
[Please submit your publication]
Jun JW, Han G, Yun HM, Lee GJ, Hyun S.
Torso, a Drosophila receptor tyrosine kinase, plays a novel role in the larval fat body in regulating insulin signaling and body growth.
J. Comp. Physiol. B, Biochem. Syst. Environ. Physiol. (2016) 186(6) 701-9 [PubMed ID = 27126913] [RRC reference]

Yamanaka N, Romero NM, Martin FA, Rewitz KF, Sun M, O'Connor MB, Leopold P.
Neuroendocrine control of Drosophila larval light preference.
Science (2013) 341(6150) 1113-6 [PubMed ID = 24009394] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np14285_0727
Strand Plus
Insertion Point 2770155
Chromosome Band 2R
Flanking Sequence
ctttggggcaaagaccttatttgtatacttcggtaagcttcggctatcgacgggaccacc
ttatgttatttcatcatgGGCGGACTCGTTGAATATATTTTGCGCTATTTTGTTTTGATT
TGTTTTTCACCTCTTCACTGCATCGTATTGTACTTgatcgaagaatacataagagagaac
cgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccgaca
tgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacg
gaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgac
ctttgntactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgtta
gaggcatatcagtctccactgaagcatnttntttttttgggnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE