Detailed Information [113269]

Strain Information
DGRC Number 113269
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP3422 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP3422 / FM7c
Break points/Insertion Site 3E3; -; 3E4
Map Viewer
Related Genes Mnt Parg
Original Number 3422
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP3422

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 104
General Information NP_lines
Embryonic Expression AS
Larval GFP cns, gut fb
Larval X-gal epi, fb, mt, gut, tr
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np16255_0727
Strand Plus
Insertion Point 3425068
Chromosome Band X
Flanking Sequence
ttttttggngtgcactgccttttngtgtatacttcggtaagcttcggctatcgacgggac
cnccttatgttatttcatcatgGTTTGGCACAAGAAAAAAAGGCAAACAAACTAAAGCTG
ACACGTGAGCTTAGCAAAGAGCGGAAAGAAGAGAGCGCTGAAGAGTTAATGCTTCAAGAG
TAATGGTTCCTTCAAAGAGAGGACGAAGAGCGCTTAAAGATAAGAGCGAAATAAGTTAAA
TTTAAGTTAAATTACAAGCTATCACAGAAATAAAATAGAGGGAACAACCTAAAGCAATTG
AATTAAATATTTTATAGCATAGTTAAACCAAGTAGGATAGAATAATAATTAAAGCTGCAA
GCGGACGTTTTGCAGAATATCACAGAAATTGTTTAAGCCCTACAAACTGAAACAAAAAAC
CAGCTAGCAATGTAAAAAATCTATGACTAAGTATTGTCTCTCTTAAAAGAGAGAGAGCGA
CATCTGCATTTTGCATTTGCAATGACAACACCCCAAAATGCACACACGCAAGTACAAAAG
CAAAGAGAAAATACAAATGCTCGTTCTCTCCTTTTTTCTCTCTCTCTCTCTTGGTTTTGG
TTNTGGGGCGCGTGATTTANGCGAAGCTGAAATAGCGGTAAAGACAACACAGTGATAACA
CAAACACCCACTTCCTTTTNCACCTTCCACGCTTTTTTGGGCCACCCACTCGNGTNGNTN
TTTTCTTTTCGCCTTANCAGGCTTGTTTAGCCGTTTNNTTGGGCNCGCTGCCACNCCTGN
CGCTTTTTTTGGGGGNCATAaagcntgcccatgactgccctggntnaaaanaaagngggg
ggggggnaacgagaagggtggnnnaaaaat


CLOSE