Detailed Information [113273]

Strain Information
DGRC Number 113273
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}dve[NP3428] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}dveNP3428 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 58D2
Map Viewer
Related Genes dve CG5819
Original Number 3428
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3428

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 912
General Information NP_lines
Embryonic Expression weak
Larval GFP part of gut
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np16275_0727
Strand Plus
Insertion Point 17314334
Chromosome Band 2R
Flanking Sequence
atnnttttgcgtgcactgccattttngtgtatacttcggtaagcttcggctatcgacggg
accaccttatgttatttcatcatgCACATGTTGCTATCCATTTGTGTGCTTTTGCATCTG
TATCAGTGTCTTTGCCCTCGTATCTGAGGCTATGTGTGTTTGCCTGTTTGTGTGTGTGTG
TGTGGGCCAGAACTCTCGACTCTCGCAGCTGAGTTTTCGGTTTCCGCTTCAGTATCGTGC
CAAACATGCTGGAAGAAGGTTGGTGTAACTGCTTTTCGCTGTGCCCAGTGTTTTCGTTCC
GTTCGCGCCGGTTATTGCTGTTTGCAGTTTGTTGTTTATGTTTAATGGCTTGGCCAGCAA
TTGGATTATGTTTGAGACTGTGGATTATGAACCTGACTCTCTCTCTCTGTGTGTGTATGT
GTTTGTCTCANCCTAAAATAAAACTAGACCTGTGAATTGTGTCCTGCGACCTGTGAGTGA
GTGACCTGTGGTGGGAAGTGGGAGCTCANGAACTGAGGAACTTACACCGGGGACAAGGAC
ACTTGCAAACACAATAgatcgaagaatacataagagagaaccgtcnncaaagaacccatt
attgttgggggtccgttttcaggaagggcaagccatccgacatgtnattctnttcagacc
aatcaaatccatgaagagcatccctgggcataaaatccaacgggaattgggggagttatc
atgatgagctgccgagtcaatcgatacagncaactgtctttgacctttggtactactctc
ttccgatgatgatgncncacttattctatgctgtctcaatggnagaggcatatcagtctc
acnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnn


CLOSE