Detailed Information [113276]

Strain Information
DGRC Number 113276
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}NP3432 / FM7c
Genotype w* P{w+mW.hs=GawB}NP3432 / FM7c
Break points/Insertion Site 18C2
Map Viewer
Related Genes nAcRalpha-18C CG8051 BcDNA:LD28120
Original Number 3432
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP3432

y[*] seems to be fixed. 29May2012 M.T.
NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 445
General Information NP_lines
Embryonic Expression scattered cells (SG)
Larval GFP gut
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np16675_0727
Strand Minus
Insertion Point 19053089
Chromosome Band X
Flanking Sequence
cttttgggttgcantgccttttttgtatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgCCAGTGACTTTGCTTTGCTTTGGCGTAGAGAATGCTATAA
AGCAGACCGCAGCAGTGGAATAGCAGCAAGTCGACTGCTGGCCGCGTAACAGTAAACACA
CCAACGAGCGGACGTACACGGAGCGAAAGANGAAGTTGGCTACCACGAAAGAGTTATTGT
TTGTTAGAAACACCAAGCGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGTACAAATA
TTATTGGGGTGCCCGTCCCGAANAGNAACAGCTGAACCNCACCCCTGNTTTTTTAACGCT
GTTCCGTTCTGGGGGACTTGGTGTTTGTTNTNCCGATNCCGGNGGGTTTNGNCNNCNNAA
TTNAACCCTTTTTTTGGGNCCGGGCATNTTTTTTTGNAAANTTTTGGGCCGCNCCCCGGG
CNGGGGGGNAAAGNGTTTTNANTTTNCNNNTNNNNAANATCCTTTNGGGGGNNCCCNNGN
NNAAAAAAAACCCCNNTTTTNGGGGGGGCCCNNTTTNNGGGGNGGGGGNNNCCCCCCCCC
CNNNNTTTTTTNNNTTTTTNNNNNNNNNAAAAANNTTTTNNNNNNGNNNCCCCCCCCCGG
GGGGAAAAAAAAANCCCCCNNNGGGGGGGGGGGGGGGNNNNTNNNNNNNNNNGGGGGGNN
GNNGNNNNAAAAAAAAANAAAAAN


CLOSE