Detailed Information [113280]

Strain Information
DGRC Number 113280
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}tlk[NP3445] / FM7c
Genotype w* P{w+mW.hs=GawB}tlkNP3445 / FM7c
Original Number 3445
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP3445

NP line. Received from the National Institute of Genetics.

Balancer FM7c
General Information NP_lines
Embryonic Expression pns (ch, TU)
Larval GFP gut, fb
Larval X-gal oenocyte, dots on gut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np11525_0727
Flanking Sequence
acaccttttttnaaaaccccccttttggntacttcggaaagcctcggctatcgacgggac
caccttntgttatttcatcatgCACTGTCGTATCACCTTTTATTTTTTATTCTTACGAGA
GAGCAGAAGAGCGAGAAAGAGCAATGGGCGAAAGAGAGCGGACTACATCGGGACATCTCT
TTTGGCTCGGTTTTTCGATTTTATTTTTAGCTGCGANTTTTTNNTTGTTGCAAGTTGTTC
GCGTGTTTGATGTGCTAACTCTGTACAAACTTTGCGCTTCTTGTTTTTCTATTGTTTTTC
CTTTTTAATTTATTACATATTTTTGGCTTTCTTTTCTTTTCGTACGATTCTTATTTCGCT
TCAAATATTCTTTTGTGACTCTTTCCACTTTATTCGTTTTGGAATTTTCCACTTTTTCCC
TTTACTTTTCCCCATCTGGGCATTAAAGCTCTTGGCTCTAACATTTTTGTTATGACACTC
TCTGATTAAATGGAAGGCGGCCGTATACACTTTACACTTATTCCAAATAATCGGATGGCA
AAGTTTTCACATAAGTCAGCATCATGTTATTCATAAAATGTATTAAGGGGATTTCCCATC
AAACATAATTTTCTCTAACAATATTTGTTTAACGAAAAATGGTATGAAATAAATATACAT
ACATATATCCTAATTCGTAACGATGTATTCATTTCATTACCATCTCATTTTACTTTTACT
CACAGGGTAAAATAATCATTCCCACTGTTTGCATGGGGAATTTGGTATTACCTGACACAT
TTACTCGTCGGTTTCTGAAGcttttttggggggggcccaggnggggggctatctttcaat
tttttttttcggncccncttaacttttnggtttgagctttgggnggtggttaccctttta
anccccccggttcccccaaaaggnccccatnccaaaaaaaaaaaaaanccnccccccccn
cnctttttncccgggnggngnng


CLOSE