Detailed Information [113303]

Strain Information
DGRC Number 113303
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP3492 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP3492 / FM7c
Break points/Insertion Site 18C8
Map Viewer
Related Genes CG14199 Pfrx
Original Number 3492
Chromosome 1
Comments NP line. Received from the National Institute of Genetics.
Balancer FM7c
Cluster id 451
General Information NP_lines
Embryonic Expression weak
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np12035_0727
Flanking Sequence
tgncnttnagtgtnacttcggtaagcttcggctatcgacgggaccaccttatgttatttc
atcatgGGATGGTATCATATCGTGGGGgatcgaagaatacataagagagaaccgtcgcca
aagaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcc
tcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtg
gagttatcatgatgagctgccgagtcaatcgatacagncaactgtctttgacctttgnta
ctactctcttccgatgatgaagncgcacttattctatgctgnctcaatggtagaggcata
tcagtctccactgaagccatcttttttttggggnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttnnnnnnnnnnnnnnnn
nnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnntnntnnnnnnnnnnnnnnnnnnnnn
nnnnntntnnnnnnnnnntnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnntnnttnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnn
ntnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnntnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnntttntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnn

Library Name / Clone Name np / np56563_0309
Strand Minus
Insertion Point 19229178
Chromosome Band X
Flanking Sequence
ggngngcccgcccgggggnggnngngtnatgtttttggnnnggatnanttggggtcatna
agcncagttttacgttagtggnagtctcttgccgacgggnaccaccttatgttatttcat
catgTACCATCCGATCGGATAGCNGGGGGAGTGCCAAANAATAAACAAAACAGCATAACC
GNAATAGGCGAGCACGGTACGGGGAACGGACCCCGAAGATNCTCTAGCTAGAGCTGNGAN
GGGTTAANAAACAAAAATATANANGTTTAAANANAANTNCGTNTAATTGGGGGGGGGNGG
TAANTNAAACNCNACGGACATGCTANGGGNNAATNAACAGGANNTANNNGNTGNNTNANN
NANNACNNNNANGNNANNNNANNANGNNNNANNNNNANNNNNNNGNNGNNNGNNNGNNNA
NNNNNNGNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNGNNNNNNNNNNNNNGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE