Detailed Information [113338]
 

Strain Information
DGRC Number 113338
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP3551
Genotype y* w*; P{w+mW.hs=GawB}NP3551
Break points/Insertion Site 35D1; -; 35D2
Map Viewer
Related Genes CG15258 nht esg
Original Number 3551
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP3551

NP line. Received from the National Institute of Genetics.

Original Comments comment1:A, comment2:35D1
Cluster id 1199
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression oenocyte (TU)
Larval GFP disc specific ! unlike Dll, no expression in the head. leg expression may be in distal domain. wing (not hal) in late L3. genital disc. tr node, may be DB fusion point. Not in hb.
Larval X-gal esg, proximal crescent, gut
Adult GFP no expression
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np13285_0727
Flanking Sequence
NNCTTTGGGNGAAATGCCCTTTTTTGTATACTTCGGTAAGCTTCGGCTATCGACGGGACC
ACCTTATGTTATTTCATCATGATCGAAGAATACATAAGAGAGAACCGTCGCCAAAGAACC
CATTATTGTTGGGGTCCGTTTTCAGGAAGGGCAAGCCATCCGACATGTCATCCTCTTCAG
ACCAATCAAATCCATGAAGAGCATCCCTGGGCATAAAATCCAACGGAATTGTGGAGTTAT
CATGATGAGCTGCCGAGTCAATCGATACAGTCAACTGTCTTTGACCTTTGTTACTACTCT
CTTCCGATGATGATGTCGCACTTATTCTATGCTGTCTCAATGTTAGAGGCATATCAGTCT
CCACTGAAGCCATCTTNTTNTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np56913_0309
Strand Minus
Insertion Point 15311773
Chromosome Band 2L
Flanking Sequence
gaagcntcgttaagtggatgtctcttgccgacgggaccaccttatgttatttcatcatgT
GTAGAATTGCCTCACGTGCCGAACTCGTACACTTGCACCAATCGAAGCCGCAAACGAAGC
GATGCCGTTATATTTGCTCTAGTGTGGGCCATATATTCAAATATGTTTACCTGTGTGCGT
CGTGCTCTCCGCAGCTGCTCTCTCTCGTCCTCTCTGCATTTGCATTCAATGCGCAATAAG
GAGAGCTATGATCCNCNNNCNNNCGGCNTAGGCCACTAGTGGATCTGGATCCTCTAGCTA
GAGCTTTTGATTNCGNCTAAATNATTANATGAAAACTTAAACCCCACGNNCNTGNTNANN
NTNNNNCNNNNANNNNNCCNCNNGGNCANGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
tnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnntn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnt

Image Files
Disc

d1 (->Large)

CLOSE