Detailed Information [113370]

Strain Information
DGRC Number 113370
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP3612 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP3612 / FM7c
Original Number 3612
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP3612

NP line. Received from the National Institute of Genetics.

Balancer FM7c
General Information NP_lines
Embryonic Expression cns + pns (ch organ subset) (TU) Nb, GMC? MT (SH)
Larval GFP gut
Larval X-gal mt, cns
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Nakagawa Y, Fujiwara-Fukuta S, Yorimitsu T, Tanaka S, Minami R, Shimooka L, Nakagoshi H.
Spatial and temporal requirement of defective proventriculus activity during Drosophila midgut development.
Mech. Dev. (2011) 128(5-6) 258-67 [PubMed ID = 21376808] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np12315_0727
Flanking Sequence
ttgngtgcactgaatttaantgtatacttcggtaagcttcggctatcgacgggaccacct
tatgttatttcatcatgTGGAAGACCAACCACCAGAGAGCAAGCAGCTTAAAGAGAGCCT
CTCTCTTGGCCTCTGATTTTGTGGGCAGACTAACGGAATCTTAGCTGTGGGAAAAACGGG
AATAAATACATATAAGACCACAGATTAGATAAGGAAGATATAAAGCTACGACTGCTTGTA
TCAACAGATATCTGTAATCTGTCATATATGCATTTATGGGTAAGACCAAGGAAGTGGGGA
TTGAAAATCGGTGGACAGAAAGAAGGGGGGCTAAAAGATAGATGTTTTAGACACGAATTT
GGGGATTTATTCCCATATCTCTGAAGAAGGAAAAGATAAGCCATCTTATGATGATAATGT
CAAACAAATAAGATTCCAAAGATTTTGTTGTTCATATTTTGAGAATCTCAGGACCTCAGC
TGATCGAAGAATACATAAGAGAGAACCGNCGCCAAAGAACCCATTATTGGTGGGGTCCCG
TTTCAGGAAGGGCAAGCCATCCGACATGTCATCCTCTTTAGACCCATCAAAATCCATGAA
GAGCATCCCCTNGGCATNAAAATCCAACGGAATTGGGGAGTTATCATGATGAGCTGCCGA
GTCAATCGATACAGTCAACTGGCTTTGACCCTTGGTACTACTCTCTTCCGATGATGATGT
CGCACTTATTCTATGCTGTCTCAATGTTAGAGGCATATCAGTCTCNTNCCCNNNNNNNNN
NNNNNNNGNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnn


CLOSE