Detailed Information [113384]

Strain Information
DGRC Number 113384
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}cib[NP4024] / FM7c
Genotype y* w* P{w+mW.hs=GawB}cibNP4024 / FM7c
Break points/Insertion Site 4A5
Map Viewer
Related Genes brn cib
Original Number 4024
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP4024

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 124
General Information NP_lines
Embryonic Expression scattered cells (TU)
Larval GFP tr terminal cells, node associated cells.
Larval X-gal stalk, gut
Adult GFP internal
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np11325_0727
Flanking Sequence
ANNGNNNNGGGNGGNGNGNNNNNNGTNGGGGGNGGGGGNTTGTTNTNTTTTNTTGGGTNN
GANTCGACCNNNNNTTNNTNNNCCCGGTATANTTGGGGGGNNNGGAAAAACCCCTNGNTN
TTTNANGGGACCACCTTTTTTTNNNNNNATNATGGNTNANNGNNNNGGNGGGGGGCGTGN
GNGNGNGCGAGTGNGGNTCGGNATTNNNAACTNNTTTNTTTTNCGNCGNNTGNTNGCCGN
TGNGNGTATGCATGNGCATGNGCATATGNGNGGGNACNNGGGTTTTGNGCATGTTTNTNT
NTGNCCAANATNCTNNGGGGGGGGGNGCGGNACGAGAAAAGNGNNCNGNANANNAANNAA
TNNATNGNGGGNNTNGGGNNTNGNANACTACAAANNTNGNAGNNGNGGAACTNGGAATNN
GAATNGNNAAAGAGGNGNNGGNGAANCTNTNGNTNNTNNAAAGNNGAGNCATNNNNNAAA
CANNNAAGNNNGAGCNCTNNTNGNTGGNGANNNGGNNNNGAANNGNGANCNGGGAANGAN
NGAANGANGGGANNGANGNNCATNNGNNCATNNNANANGGNNGAAGNNNNTNTNNGNGNG
ANCNNNNNTGNGNGANGNGNGNGNNGGNNAGNGGNNANNNGNGNNGGGNGNGGNGNNGNG
NNNNTNGGNNNNNNNNNNNNGNGNNNNNGNNNNNGNNNNNNNGNNNNANNGNNNNNNNNN
GNNNNNNNNGNGNNNNNNNNGNGNGNNNNNNNNNNNNGNNNANNNNNNNNNGNNNGNNNN
NNNNNGNNNNNNNNTNNNNNnnngnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnngn
nnnnnnnnnnnnnnnnnnnngnnnnnnnnnngnngnnnnngngggngnnnnngnnnnnnn
nnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnggngnnnnnnnnnnnnnngnnn
ngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
gnnnnnnnnnnan

Library Name / Clone Name np / np28735_0807
Flanking Sequence
GTTTTTTNGNNNNGACCNANCGTGGGGGAAAAAANCCTCCCTTTTTNGGGGACNNANAAA
AANCCCTCGGCTATNACGACGGACACCACTTTTTTTGGNNTTATATTTTGGAAAAAAANC
CCAGAGNNGCCCCGGNGNGTGCTGTAATGTGCCGGAGACGATNCTNAACAGCACAATACA
CGCGTNCGCGCNCGTCCGCGNTGTGTGACTATCNNGAGGCCAGACTACCGNATNGGAGAC
NNAGGNCNGNNTTTTTTTTTTGNNNNNNCNCCNNTTTTTTTTGGGGGATAGCTGNNNNCT
GCAGCGTGTCCCACAGNAGNCACACACTGGGCGGTGACNCGAAAATTGTACTCGCGACGN
GTGAGCGTGACGCATGCTGTACACTCTTAACCATACTTAAATGAGGGCAAAGCACTCTCG
CCCGCAGCCGTGCGAGTGAGCGAGATGACTATACAAGCAGCATCTGGGCATAGCGAGGCA
GGGTTGCTAGTGCCAGTGTTGTACAACCATCGGCGGTCATCGGGAGTGGGCCCGTTATCG
CTATCGNCGCTCAGCTGTTACGNAGCGTGTTTGNTACGTCGTAAATTTNGNGCGGAAAAA
CCGCAGAGTTTTCATTGCCGCCGTGAAAAAAAACATAAATAATGGNCNGNGCCCTTTCAG
NGGCGCATNGCGGGCGTTCCGGCGGNATTGGGNCCGCCATTGGCAAGCAGCNGANAAGCC
GNGAATTTGAAAGGGCGGNCAAGCGGGTAACCGGNGCAGNNCGNTCGAAGAATACNTAGA
AAGAACCCGNCNNCAAANAAccanttatnggnggggggccnnnntaggnagggnangcca
tccgnaagnnatnctntncnnaccaatcaangctggagannctccccgggcntaaatcna
nngaatggggggnnntnatgangagcnggcnnngnnancnatacannnaanggnntngan
cntangaaat

Library Name / Clone Name np / np56353_0309
Strand Minus
Insertion Point 3847244
Chromosome Band X
Flanking Sequence
cttttactncgcacttattgcaagtcatacgttaagtggatgtctcttgccgacgggacc
accttatgttatttcatcatgGTTTGAGCCACACAAAAAAAAANCAAAAANTANTNGTCA
ACAAANGGGGCGACGACAAAAGCGCTTNAACAGNTGNGGAAAAAAGTTNCAAAGTAGCAG
AAAAGAAATGGAAACGNGGNGAAAGATGAAAAAGTAACGGNCTAGACAAGCNCAATAAAT
NTTTATAACAAATCCGNTGCCNTTTTCGCAATCAACGAANAAGCGCAGTCAACAAAAACC
AGTTAGGATTCCCCATTACCCCCACCGNATTTTACAANGGCAAAAACGAAATTACCGGNG
ATCCNCGGCCNGNCGCTTNGGCCACTAGGGGATNTGGATCCTTTAGCTGGNNTTTTGGGT
NCNNNNAANTNNTANNANGNNNNANTTTNAACCCNNNNNNGNNGANNNGGNTTANNNNNN
NNNNNANCCCCCNNGGCNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNNNNNNNN
NNNNCNNNNNNNNNNNNNNAANNNNNNTTNTNNNNNNNNNNNNNNNNNNNNNNNNNNNGG
GGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNCNNNNNNN
NNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNTTNNNN
NNNNNNNNNNNNNNNNNNNNnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np70505_0810
Strand Plus
Insertion Point 3847237
Chromosome Band X
Flanking Sequence
gtcaacgtgcactgnanttantgtatacttncggtagncttcggctatcgacgggnacca
ccttatgttatttcatcatgGCTCAAACTTTAGNATTTGCGCGTGTGTGTGTGCGAGTGC
CGGCCGGCATTTTTAACTTCTTTTTTTTCCGCCGTCTGCTTGCCGCTGTGTGTATGCATG
TGCATGTGCATATGTGTGGGTACTTGGGCGGGGCGCATGTGTGTCTCTGCCCAATATCCT
CCCCCACAGTGAGCGGCACGAGAAAAGTGTCCTGCAAATTAATTAATTCATTTAGTGCCT
TGGGTATCGCAGACTACAAATATTGCAGTCGAGGAACTTGGAATTTGAATTGTTAAAGAG
GCGTTGGCGAAACTCTCGCTACTCCAAAGTAGAGCCATTTTTTAAACAACTAAGTTCGAG
CACTTCTTGCTGGCGAATTGGCAACGAAAAGTGAACTGGGAAAGATAGAAAGATGGGATA
GATGTACATATGCACATTTCACAAGGATGAAGTCACTATCTGTGCGACCTCGACTGTGCG
ATGTGTGTGCTGGCGAGTGGCGAATTGTGCTGGGCGTGGTGCTGTGTCACTTGGATATCC
AATATCCAGCGATTTTGAAATTGAATATATGACTAAACGCAGCCCGCCTGCATAAAATGT
GTATATAATGTGCGCAACAACAAAGTGCTTAAAAATTCATTGCAAGTCGCCGATTGCGCC
TCCCTTTCGTTCTGTCTACCCCCCTCTCTTTTTTCATTGGCTATCACTAGCTACACACAC
ACACACACTTGGGGCNTTTNtgcagganaagagggtgtnaatgcaaaagcggncgtgtct
ggcattttttaatttnccccatttttcggggctncangttttt

Image Files
Disc

d1 (->Large)

d2 (->Large)
Larval GFP

g1 (->Large)


CLOSE