Detailed Information [113432]
 

Strain Information
DGRC Number 113432
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP4299 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP4299 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 35D1; -; 35D2
Map Viewer
Related Genes CG15258 nht esg
Original Number 4299
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP4299

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1199
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression oenocyte, cns (TU)
Larval GFP esg-like.
Larval X-gal Proximal ring in leg and wing pouch
Adult GFP wing hinge. ventral body wall.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np13765_0727
Strand Plus
Insertion Point 15311856
Chromosome Band 2L
Flanking Sequence
cntctttggggaaaaaaccccntttttggntacttcggaaagccntcggctatcgacggg
accaccttatgttatttcatcatgCGCCCGAGAGAGCGTTCTCTTTTGGCAGCTTCGTGT
AATGAGCCGAGTGCCGAGTGCAGGGGCAGTATAAAAAGGCCGCACCACCGCCAAACTCGC
TCAGTTATTCCCAGACTCTAACCGATTCACATAACCATCTGTTTTTNNCGCAATATACCC
GAAATATAACCGATATTCAATCGCTTTGCTTAACGGAACACGCGTTTGGTATCTGTGCAT
Cgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgt
tttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaag
agcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtc
aatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgc
acttattctatgctgtctcaatgttagaggcatatcagtctccactgagcatnntnnntn
ttggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

d2 (->Large)
Larval GFP

g1 (->Large)

g2 (->Large)

CLOSE