Detailed Information [113455]

Strain Information
DGRC Number 113455
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}stg[NP4448] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype w*; P{w+mW.hs=GawB}stgNP4448 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 99A5
Map Viewer
Related Genes SP1029 stg CG14506
Original Number 4448
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP4448

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1672
General Information NP_lines
Lethality lethal
Embryonic Expression cns + pns
Larval GFP cns + pns
Larval X-gal sg, gut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np69725_0810
Strand Minus
Insertion Point 25070370
Chromosome Band 3R
Flanking Sequence
atnnttngggcgaanaaacccnanttttnggtgtacttangnaaacccttcggctatcga
cgggnaccacnttatgttatttcatcatgGTTCAGCCTTTCGGTTCCTCGTTCGGTGAAT
TGAGATTGTGCGGTTCAAATTATTGAAGAAAAAGAAAAACCTCGCACAACCACACTCCGA
AATACAAAACAAAAAATCATGCTCAAACGGACACATTAACAANTTTTNNAACCAAAAAAC
CNTAATTTANNTAAAGGGCANTNNTNGCCAAAACCCAGGGCNTCCCNTTTAAANTTTTAA
AANNAANNNGTAAANGNGGGCNGGGGGNCCAAAANNAAATNGGGTTTNAGNANTTTTTTG
GGTTTAANACTCNCCNGNNAAANAAAANNTTTTGGGTTTTTNGANGNACCCANNGCACCN
NNTANCNNANCAAACCCANCAAANGGNTGGGGNAAANTNTNGGGGGGGAAANNANNNGCN
GCNGGGNTGGNAANNTNNGGNAATTNTNCCNCCCAGGGNTTAGNANCNGNAANCCCTTTT
NGCCCCNGGAATCCCAGTNGAAAATCCCCNANAAAAGGGGCAGGTTNANGNGCANCNGCN
CCACCGGCANGGCAAAAAAAAATTCCAAAAACCGGAAANNNTAACNGGGGGGGCCANNAA
AGGAANNNGTTTTTTTTNTCCCCNNNGGCCGGTTGGTTTTTGGCCNGATTTTNNTTTGGG
NCCCCACNNGNGGTTTGGGGGCNCGTTGGCCGTTTTTNATTNATNAAACGGGTTTCCGGG
GGGNTCCAAAAAAAGGCGGCggcaaaaanggnttttggcccgccgccccgccgncagacc
attttttttttttnggatttgggccttttttcccccggggnttttggggggntg


CLOSE