Detailed Information [113498]

Strain Information
DGRC Number 113498
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Myo31DF[NP4681] / CyO; TM3, Sb[1] Ser[1]
Genotype w*; P{w+mW.hs=GawB}Myo31DFNP4681 / CyO; TM3, Sb1 Ser1
Break points/Insertion Site 31F4
Map Viewer
Related Genes CG13144 CG6094 Myo31DF
Original Number 4681
Chromosome A
Comments FlyBase Insertion: P{GawB}NP4681

NP line. Received from the National Institute of Genetics.

Balancer CyO; TM3 Sb Ser
Cluster id 1151
General Information NP_lines
Embryonic Expression cns, scattered cells, 2strains? hg
Larval GFP all gut
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np41795_0907
Strand Minus
Insertion Point 10499217
Chromosome Band 2L
Flanking Sequence
GGNCCCCCCTTTTTGTNTTTNATTATTGCCAANGNCCNTNTGCAACTTTCATTGAATGCG
GTCNAGTGCGGTNGNGCNACGGCCGATTGTTGTTATTAATCCGCCGCAAACGAAACTGAA
TCCAGGNGGGCACTCACACCGNTCGAAGAATNCATAAGAGAGAACCGTCNCCAAAGAACC
CATTATTGTTGGGGTCCGNTTNCAGGAAGGGCAAGCCNTCCGACNTGTCATCCTCTNCAN
ACCAATNAANTNCATGAAGAGCATCCCTGGGCATAAAATCCAACGGANTTGTGGAGTTAT
CATGATGAGCTGCCGAGTCAATCGATNCAGTCAACTGTCTTTGACCTTTGGTACTACTCT
CTTCCGATGATGATGTCNNACTTATTCTATGCTGTCTCAATGTTAGAGGCATATCAGNCT
CCACTGAANCCAATCTATTTGTTTCGCTCCGNTCCNTNNCCCCCCTTTTNNTTCNTTTCG
CCCTCNTTTTNCCCCCTNTTTTTTNTCTNCNTTCCCCCCCGNNCNTANCGNNACCGATCT
GNGCCCCNNTGNCTCNTNAACNCNCTTTNTNCTCNTTNTCCTCGCNANCNCTCCNTCNCN
TCATTTTCTTTTTNCTTCCNCNATTCANTCCTNTGTCCCNTTNNTTTCNTACTCNNTCTT
CCNTTNTTTCCAANTCNNNTTCNNCACNTTCNNTNNTNATNTNCCTGTNNNNCNTTTTTC
CNCCCCACCCATATATNCCCCATTTCCCANTCNTCGTNTTNTCNTTANCTACNATCANCN
CTNTATNNNCTNTTTCACACnttcnctcctntacancanctcctngcttnttcnanttnc
ttnttntntccccanttnctnncnntantnttcncnccnctntcccgnnnncntccttcc
cntncgtcgtn


CLOSE