Detailed Information [113530]

Strain Information
DGRC Number 113530
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}Uba1[NP4810] / CyO
Genotype w*; P{w+mW.hs=GawB}Uba1NP4810 / CyO
Break points/Insertion Site 46A3
Map Viewer
Related Genes Uba1 Mmp2 CG30002
Original Number 4810
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP4810

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 637
General Information NP_lines
Lethality semi lethal
Embryonic Expression muscle subset (SG)
Larval GFP sg
Larval X-gal sg, tr
Adult GFP abdomen
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np29365_0807
Strand Minus
Insertion Point 4753526
Chromosome Band 2R
Flanking Sequence
annntttgggggaaaaaaccctatttttngncttcggtaagactccggctatcgacggga
ccaccttatgttatttcatcatgGAGCAGCAGTAGCAGCAACAACTACGAAAATCACGAC
AAAGCAGGCGGCGTTGACATTTCGGGCAAGTGCCAGAGCAAGACGACTAGCGAGCACCAG
CTGGAATTGTGCGTATCGTCGTCTACCTCTGACACATGCGGNNTTTNTGCTGCGGCGAAG
CGAGCCGAAAAGCAGAAACTGAAACAGAGCCAAGGAAGCGGCGACGACGTTAGTACCTCG
TCAGCAGTGGAAAAGGAAGGAAGCAAGCGGCCGGAGAAGCGCAATTACCTGAACACCACC
ACAATAGAATCGCAAGAAGCCTCCTCCAGTGCATCCGCCACTAGCAACAGCAACAACAAC
GTCAGCTCCAGCAACAATAACAGTAATAACAGCACTAATAACCGACAACTGGAAGGAAGC
AGCAACATGGCTGGAAACAGTGCCGCCGCCGGCGGAGATATCGATGAATCGCTGTACTCG
CGCCAATTGTACGTCCTGGGTCACGATGCGATGCGTCGGATGGCCAATTCGGATATCCTT
CTGTCGGGACTTGGAGGACTCGGCCTGGAGATAGCCAAGAATGTGATTCTGGGCGGCGTG
AAATCGATCGAAGAATCATAAGAGAGAACCGTCGCCAAGAACCCATTATTGTTGGGGTCC
GTTTTAAGGANGGCAAGCCATCCGACATGTCATNCTNTTCAGACCAATCAAATCCATGAA
GAGCATCCTGGGGCATAAAAtccacggaattgggggagtattatgatgagctgncgggtn
aatcgatacaggcaactggctttgaccttggtactactctcttccgaagaagatggcgca
cttattctatgctggctaatggtagaggctatagctacngcnnnnnnttttttttnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE