Detailed Information [113560]

Strain Information
DGRC Number 113560
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}RhoGAP18B[NP5055] / FM7c
Genotype y* w* P{w+mW.hs=GawB}RhoGAP18BNP5055 / FM7c
Break points/Insertion Site 18A3; -; 18A4
Map Viewer
Related Genes RhoGAP18B CG7502 inx5 412{}165
Original Number 5055
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP5055

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 439
General Information NP_lines
Embryonic Expression weak
Larval GFP sh. sg only.
Larval X-gal sh. not in disc.
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np43475_0912
Strand Minus
Insertion Point 18884619
Chromosome Band X
Flanking Sequence
antnttaaacgtgcactgaatttaantgtatacttcggtaagcttcggctatcgacggga
cnaccttatgttatttnatcatgTCACCGCCTATGACAAATCGTTCAGCTTGTGGCTGTG
GCACCAGCAACAACAACAGCGACAACAACCACCgatcgaagaatacataagagagaaccg
tcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccgacatg
tcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacgga
attgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacct
ttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttaga
ggcatatcagtctccactggcatctnnttnnnngggggggnnnnnnnnnnnttnnnnnnn
nnnnnnnnnnnnncaaaaaaaannnnnnnnacnaangnntnnnnnnnnncnnnnnnnnna
nnnnnnntnnnaaannnnnnnnnnaaggncntnnnnnnnnggnaannnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np50875_0912
Strand Minus
Insertion Point 18884619
Chromosome Band X
Flanking Sequence
tgacaancgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgTCACCGCCTATGACAAATCGTTCAGCTTGTGGCTGTGGC
ACCAGCAACAACAACAGCGACAACAACCACCgatcgaagaatacataagagagaaccgtc
gccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtc
atcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaat
tgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgaccttt
gttactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagagg
catatcagtctccactgagcatnnnnnnnnngggggggngngnnnnnnnnnnnaaaancn
nnnnnnnnnnnnnnnnnncnnnnnacnnnnnnttnnncnnnnnnnnannnnnnnnnnnnn
nnnnaannannnnnncacnnatttnnnnnnngnnnnnnnnnnnnaaannnnaaannnnnn
ntnnnnntnnnnncatnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnn

Image Files
Embryo

e1 (->Large)

e2 (->Large)


CLOSE