Detailed Information [113600]

Strain Information
DGRC Number 113600
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP5132 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP5132 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site ---
Map Viewer
Related Genes CG40190 CG40191 CG40192
Original Number 5132
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP5132

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 2084
General Information NP_lines
Embryonic Expression weak
Larval GFP sg only.
Larval X-gal not in discs. (s.g.)
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2018-03-01
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np45305_0912
Flanking Sequence
GTNAACGTGCACTGAATTTAAGTGTATACTTCGGGTAAGGCTTTCGGGCTATCGACGGGG
ACCNCCCTTTATGTTATTTTCAATCATGGCCCTNAGGACTATGCTAACNNCCTGGGTTTC
AGGNGGGGNACNGATNAGTGGTTCCNTGNCTACNACAACTCNGGCCGTACCTGACCTAGC
TGATCGAACAANTCATAGGAGAGACCCGTCGNCAAAGAACCCATTATNGTNGGGGTCCGT
TTCAGGAAGGGCAAGCNATNCNACNTGNAGCCNTCTTGGGNCCAATCNAATACCANGAAG
AGCNTCCCTGGNCATAAAGNCCANCGGANTNGTGGAGNCATCATGATGAGCTGNCGANTC
AATCGACCAGTNAACTGTGATGAGACCTTTGTTACTACTNTNCTTGCCGATGATGATGNN
GGCACTTATTCTATGCTGTNTAANGTNNNAAAGGGCATATCAGTCTCCACTGAAGCATNT
TTTTTTTGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np66083_0309
Strand Plus
Insertion Point 2137721
Chromosome Band U
Flanking Sequence
gngggcgcgccctcgtcctgtttttttgggnnngatncttncgtngtcacttaaanccag
tttttcgntgaagtggnatgtactccttgccgacgggcaccaccttatgttntttcatca
tgGTCTTAGGNATGAAGCCCATAGGGGCAGAGAGAAGCATACGATCCTNTAGCTAGAGCT
TTGCGTACTCGCAAATTATTAAAAATAAAACTTTAAAAATAATTTCGTCTAATTAATATT
ATGAGTTAATTCAAACCNNTCGGACATGCTANGGGANGANAAACAATAATNGGGGGGGNC
GNNCNAANGNTTNANGANCAATNATANTGCTATCCCACTCAGACGNAATNNNCCACTCAA
AATNCTATNCCNTNCNCTCGCNCTNANTGNCNGCATACGNNAAGTGGATGNTGGTNGCNG
CGGGACCACCATNATGTNATTAANAATGGNCTNANGTNTGAAGCCNNTANGGGCAGANAG
AANNNACNAANCTNNANCTNGAGCTTNGNNNNNTNNAAANNNNNAANNANANAACTTAAA
ANNNNNTNNNNNNNNNNANNNANNNGNNNTNNNNNNNNNNNNNNCNNNCTAGGGNNNANN
ANNAANNNNANNNNNNNNNNNNTNNNNNNNNGGGNNNNNNNANNGNNNNNNNNNNTNNNN
NNNNNTNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNCNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTNNNNnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nannnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnncnnccccn


CLOSE