Detailed Information [113659]

Strain Information
DGRC Number 113659
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP5272 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP5272 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site ---
Map Viewer
Related Genes CG40260 CG40315
Original Number 5272
Chromosome 2
Comments NP line. Received from the National Institute of Genetics.
Balancer CyUW14
Cluster id 2061
General Information NP_lines
Embryonic Expression weak
Larval GFP sg only
Larval X-gal not in discs. (s.g.)
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Shuai Y, Hirokawa A, Ai Y, Zhang M, Li W, Zhong Y.
Dissecting neural pathways for forgetting in Drosophila olfactory aversive memory.
Proc. Natl. Acad. Sci. U.S.A. (2015) 112(48) E6663-72 [PubMed ID = 26627257] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np49625_0912
Strand Plus
Insertion Point 671103
Chromosome Band U
Flanking Sequence
tgtnacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgGCCATTAGAGAATATGATGAAGAAGGGACATGTAAGAAgat
cgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttc
aggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagca
tccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatc
gatacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcactt
attctatgctgtctcaatgttagaggcatatcagtctccactgagctcttttttttttgg
ggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnncnnnn
gnnnnnnnnntnnntnnnnnnnnnnnncnnnnnncaaannnnnnnnnnnnnggnnnnnnn
nnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnn
nnnnnnnnnngnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnncnctnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np67933_0309
Strand Minus
Insertion Point 671110
Chromosome Band U
Flanking Sequence
ttttctcgcacttattgnagnatacgttaagtggatgtctcttgccgacgggaccacctt
atgttatttcatcatgCTAATGGCTATACACACTGGCGTGTGCCACATTGTCATCTCTCT
CTAACACACTATTTATGACCACTCGATCCTCTAGCTAGAGCTTNGGGNACTNGCNNATTA
TNAAAANTAAANCTTTANANATNATTTCGTCTAATTAATATTATGAGTTAATTCAAACCC
CACGGACATGCTAAGGGTTAATNAACAATCANAACCCTGCGTNNNTGCTANTNNATANTC
AACANTGCATNTCANTNCANTNTACNNCACCNTNGNGNTANAAAANCGANANTGNATNAC
CGTTGCNAATNGGACGANGNTAAATNATTTGATNAGTGCNTACGGCTATNCGCANNTGNN
CAGNGNCANAGTTGNNATTTNTNTNTGNNNNCTATGNNAANANNANATNNNTNCTNNNNN
GNNAANNNNNANNNNNNNNANNTNGNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnn

Image Files
Embryo

e1 (->Large)


CLOSE