Detailed Information [113661]
Strain Information
DGRC Number 113661
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}jing[NP5276] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
w*; P{w+mW.hs=GawB}jingNP5276 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 42C1
Map Viewer
Related Genes CG15234 jing
Original Number 5276
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP5276

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 534
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression weak
Larval GFP sg. trachea.
Larval X-gal not in discs. (s.g.)
Adult GFP internal only
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Library & Clone Information
Library Name / Clone Name np / np49655_0912
Strand Plus
Insertion Point 1674090
Chromosome Band 2R
Flanking Sequence
tgaattaagtgnnacttcggaagcttcggctatcgacgggaccccttatgttatttcatc
atgGCTTAGCGTTTATCGACCCGTTTTGTGTTCTCTTATTCTGTTGCGCTCTTCTCCTTC
TCTTGTTCGCTCTCTTGAAACAATAATTTCCCTATTTCTCGTGTAAAATGAATACATGTT
TTTTACAGTTATTCAAAATTAAAATATTTTGTATCACAAACACGGAGTAAATCGATTATT
TTAAGATTAATTTTAAAAATGTTTTGCGCGCATGTTGTTGAATTTAATTTCGCAGCTGAA
TGCCTTGGGAGTTCTCTTATTCTCTTTAGCTCTTCTCCTTCTCTTGGTCGGGCTCTTGCA
ACCATATTTTCCTTATTTCTCGNGTAAAATGAATATATGTTTTTTTACAGNTTCTCTAAA
TTAAAATAATTTCTATCACATCATCGAGTAAATCGATTTTTTAAAGAATAATTTTAAAAT
TGGTGCTTGCGCGCCCCTTATTGAATTTAGGTTCATAGCTGNTTGCCCTTTACTGNGGGG
TGGTTTGGGAAAATTATCAACTGGTAGCCNCGCCTGTAGAAGNNACAGCGCTTGNGACNG
GCATTCTNTNACCCAGGCGGGGAAANAACATCCCANAATAATTTGGNGNGGGCCTTCCAC
CCCGGCNCGGCAATAAACCATCCAAGGAAAAAAGGTTTTAAAAGGGGGNGNTNAAAAAAG
GCCAAAGCCTTAACCAAAACCCTNTTTAANGGGCCAAGGCAATGGNAATGGCCCNNGTGG
GGGNAATNAAAATTNCCNGGgcaattggncccccnacnaaccaattaaatntactttccc
ctttccttgggcccgggtccaaaaggggnggggtgggaacccngggcagnntttaanccc
cggggg

Image Files
Embryo

e1 (->Large)

e2 (->Large)

CLOSE