Detailed Information [113710]

Strain Information
DGRC Number 113710
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP5385 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP5385 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 78A1
Map Viewer
Related Genes fng CG10586
Original Number 5385
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP5385

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 2011
General Information NP_lines
Embryonic Expression psp, anal pud,
Larval GFP asp, psp
Larval X-gal ventral pleural region. a part of foregut. (s.g.)
Adult GFP internal abd , thorax.
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np50605_0912
Flanking Sequence
gagncgtgcactgnatttaagtgtntncttcggtaagcttcggctatcgacgggaccacc
ttatgttatttATCATGACCCCCACTCAGCCCACTTCTgatcgaagaatacataagagag
aaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccg
acatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatcca
acggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtcttt
gacctttgttactactctcttncgatgatgatgtcgcacttattctatgctgtctcaatg
ttagaggcatatcagtctccactgaagccatttattttgngggggggnttttttttttga
nttgccnngncaantnatnccggnaacnnngtttnaacnttgngacnacnatctttcnan
aaaantgtggnaccgnttttttgngggnacaacggtanaagaaaatancccccccttnna
ncatnnnnnnnnnnnnnnnnnnnnnnnncnaannannggnnnccctnnnnntntngnaaa
annnnnnncnnncnnnnntnnnnnanaccnnngggncccnnnnnnttttttnnnnncnnn
nnnntttnannnnnnaaannnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np68313_0309
Strand Minus
Insertion Point 20867054
Chromosome Band 3L
Flanking Sequence
tttttngtggcacttatngcagttttacgttantggntgtctcttgccgacgggnaccac
cttatgttatttcatcatgGTGGGGGTCGACACACGAGCACATGAAAATTGCCTTCGGCA
GCTACTGTGGCACAAGCTAAAGAGAGAGGATGAGAGCGAGCGCGATCCTCTAGCTAGAGC
TTTGAGNACTNGNNNATNATTAAAAATATAAACTTTAGAATATNATTTTTTCTAATTAAT
ATTATGAGTTAATANAAACCCCACGGACATGCTAAGGANTAACTAACAGGTAATTAGTTT
NTNNACCNTNCTTCATATNNAAGTANANNNANAGTANNTTATTTTANNNATATTANTTNA
TACCNATNTANTTTTTTTTTNAGATATNTTNNNTACATNNTTTNTNTNNNTNANTANNCT
NTCTNCTCNNTTTTTTCCCCTTNTNNCCCNATTNNNNTNNCCNTTANTTATTATNTTTTN
TNTANNANTTNNATNNNAATATTNNANNATNTCANTATTNNNNCNTNNNCTNNCNCCCCN
NTNTATTTTTNTTTTCTNGNNATTGNNNGATNCANNTANCATANGATNNNANANNNANNT
CNNNNGTACATNTNTTNTNCTNTTNNTCNNNAATTNTTATNTNTTNANTNTANTTATATC
ATNTTTNNNTATCCATNGNTNTNNNATNTATTNNNATATNTNTAANATNATNCNATATTN
CCNCCCCCNCACCTANNCNATNNTTTTTCTTCTTNNNNNTNCCCCNTTATTACTTTTNTA
TTNNCNCNCAGNANCTCNNTnatancctnnatntnaaatccnatttnatntntttaatat
tcnttnntnancgnntncnncnnntacnntatntcccccncntttnntnnnctnanttcn
agtccnnttnttttcnntttattntttattnnatanagtcnntngtanntngnncnnctn
atatntctantntatttcnc

Image Files
Disc

d1 (->Large)


CLOSE