Detailed Information [113778]

Strain Information
DGRC Number 113778
Genotype with FlyBase Link y[*] P{w[+mW.hs]=GawB}CG3600[NP5906] w[*] / FM7c
Genotype y* P{w+mW.hs=GawB}CG3600NP5906 w* / FM7c
Break points/Insertion Site 2B17
Map Viewer
Related Genes CG32802 Stalker2{}22
Original Number 5906
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP5906

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 50
General Information NP_lines
Embryonic Expression Only patchy stain.
Larval GFP weak general
Larval X-gal checked
Adult GFP ubiquitous
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np46935_0912
Strand Plus
Insertion Point 1720548
Chromosome Band X
Flanking Sequence
gnnnggnggngggnngnnangggngggnggtnngttttggnnngtttttgggnnnnaagc
cntttttgttacttcggtaagcttcggctatcgacgggaccaccttatgttatttcatca
tgGGCTACACTGTCATTGCCGTTTGCCGAAGTCGATGTCGAAGTCGGCCGTTGAGTAGCC
GATGTGAGAGCGCGAGAGCTGGAGAGCTACAGTGGTAGCTCCACAGAGCGGATTTCTCCA
CCAGTCGCATTGCCTGATTATTATCTTTATTAATGTCTATTTAATNCTATGCTATCAAGA
GTATGCGATAATATACAAGTACTTGTCTTTGTTGGACATTGTAACGAGCGAGCACTGTAC
ACGATAACTACTAAAAAAAAACGAATAAAAACCGAAATAGNGCCTTGCATTTTCGTTATC
GAAATAGTCAGAAATTGGGTAAAGCACAAGGGGAGCTGAAGGGGGCCCAAAAAGAGATGG
CAAACGAGCGGACTGCGCAACTTTTTTATACCCAAAGTCATTCACCTTTCGCTCTCTCAA
ATGTTCTGCTATGGGGCTTTTTTATTTACGATTACTTCCACCACCACGAACGAACTCCGC
TTAAAAAGACTTCTCTCAATTCTCTCTTTTCAACTGCGCCGNCGACTTAACGCCCACACA
CACACACAAACCCGAAAACGTTGGCGGATGGAGAGAGAGAAAGAGCGAGAATGGAGACAC
CAATAGAAAACGAAGCGTCAAATTATTTTTTTTGATTTTTTGNNGGGCAATGAAATATAT
TGACAGCAGTTTGGTCTGNGtgggggangagcangaagngggggggtttggtttttaact
ttctctnggcaaaaagaaaatgaattacctgcaaggcaattagaanagcanccngctggg
aactggttacatggaaaaaananccancgntggngggtttgttccnanggaaaatttttn
gggggtngganaaancaataagaanaaaccggnnncaaaaaaccctttttgggggggg


CLOSE