Detailed Information [113781]

Strain Information
DGRC Number 113781
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}CG9171[NP5910] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}CG9171NP5910 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 25F5
Map Viewer
Related Genes CG14005 CG31913 CG9171
Original Number 5910
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP5910

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1045
General Information NP_lines
Embryonic Expression Subset of PNS?
Larval GFP gut, epi, tr
Larval X-gal checked
Adult GFP muscle in tibia, genitalia
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np47715_0912
Strand Minus
Insertion Point 5792412
Chromosome Band 2L
Flanking Sequence
gnnngngnggnggggnnngnnnangggnnagggggttttgtttnttggnnngganncaac
ngnggttaanaanccccctttttggggactnncggaaagncttcggctatcgacgggacc
accttntgttatttcatcatgCCACAGGACTTTNNGNAGGCTTTTCCACTTTTTCGATTT
NGAGACTTCGAGCGAAACGGTCGTGTTTTTCGCGTGTGTGCGGGTGGCGGACGCGCGTGC
CAATCGGAAAAGGCCTTTAAATCAAATGAGTGGCTCGCCAAAGGAGCGCATCAAGGTGTG
TGCGNGGGGNTCGAGTGTGTGTGCTTGTGCGGTGCGGAGAAAGCCAGCCAGCCGCCAGTC
TGGGATAAAAATAAAGATTAAGATTGGGATAAAACAAAgatcgaagaatacataagagag
aaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccg
acatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatcca
acggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtcttt
gacctttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatg
ttagaggcatatcagtctccactgagcatnttnnnntngggnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Adult

a1 (->Large)

a2 (->Large)


CLOSE