Detailed Information [113784]
Strain Information
DGRC Number 113784
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}crp[NP5916] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
y* w*; P{w+mW.hs=GawB}crpNP5916 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 35F1
Map Viewer
Related Genes pkaap crp 1360{}389
Original Number 5916
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP5916

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1209
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression No specific stain.
Larval GFP strong internal stain
Larval X-gal checked
Adult GFP abd, probosis
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Library & Clone Information
Library Name / Clone Name np / np47775_0912
Strand Minus
Insertion Point 16264836
Chromosome Band 2L
Flanking Sequence
catgctnnnngggnnaaaaacccattttttttgtatacttcggaaagccttcggctattc
gacgggaccaccttatgttatttcatcatgGTCTGTGCCCCCTTCTCAACATCCTCTCTT
TTTTTCCGCCGCTCTCGTCCAGCGTTTGTGTTGTTGCTGTTTTTACGCTCTGCCTTTCGG
CGTCCATATTGTAAAACGGCTGTTTTGTCAATTTGTCAGCAGTGTCGGCAGACGGGCAAC
AGTGATGGCACAAACATGAGTCAAGGGTACAGCTGTTAGAAACGATGATTTTTTATTTGC
TTTAACTTTAGAAGTGTAGAGTTCAGTAGAAGCCACAATATTAAAAATACATTTTTGGTT
TTTCTATACTATTATGGAGGTGTATTTTTAGTTTCTCAAATATTTGTACCTTTGATACAT
ATGTATGATACATAAATGACTTTAAGCgatcgaagaatacataagagagaaccgtcgcca
aagaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcc
tcttcagaccaatcaaatccatgaagagcatccctgggcataaaaatccaacggaaattg
tggagttatcatgatgagctgccgagtcaatcgatacagncaactgtctttgacctttgt
tactactctctttccgatgatgatgtcgcacttatttctatgctggcccaatgntagagg
catatcagtctccactgagcatnttttttttgggagagnttnnngtgntgnnnnggttnn
tntgtngntncgnnncttcncagtnttntanngnncgtntgntctnccttttntctnttn
nctngtntttnnnnaanntttttncnnnccngttntntnntnttgtttnctcntacgtnn
ttntctnnttnantnnttcgnnnnttnctttgtnncttcgtngtcnnntgtcnttnggna
ntntnttnnnnttttnnnnccnnttngnnnnannnttannntncnnttntntnnaaat

CLOSE