Detailed Information [113832]

Strain Information
DGRC Number 113832
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP6064 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP6064 / FM7c
Original Number 6064
Chromosome 1
Comments NP line. Received from the National Institute of Genetics.
Balancer FM7c
General Information NP_lines
Embryonic Expression weak CNS, PNS (ch) (TU)
Larval GFP sg, midgut, mt.
Larval X-gal sg, midgut, mt.
Adult GFP base of ant (S1), not in leg. gut, mt.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np42645_0912
Flanking Sequence
ancntngcgtgcactgcaatttaagtgtatacttcggtaagcttcggctatcgacgggac
caccttatgttatttcatcatgTGCCGGCCTTTGATAgatcgaagaatacataagagaga
accgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccga
catgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaa
cggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttg
acctttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgt
tagaggcatatcagtctccactgagccatttnntttttggggncgggntttttatttaca
ttatcttggacaaataatcctgntaacaatgcttttatatcctgtaaagaatccattttc
aaaatcatgtcaagggcttctngaggaaaaatcagtngaaatagctgntccagnctttnt
agccttgattccncttntgnnanatgtgccctanncagnggngaccttttggntttggga
gagnagcgacnctcccagntgntnttnanacncttggngcncttnngnttttntttggng
cacttganctttttaagnnngnaatatcgnnnncntgnnnnnnagaanacngnnncttna
tntttnangangnttgnttnaanctnggnnnnnnnntgnnnnntgnnnannngnncntnt
ttntttnntnnngncccncnnnnggnnnnngnnnnnaaaaaaannnnncnnnnnaanntt
tnntnnnaaannnaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnc
cccntnnnnnttnntnnnnnccnnncnnnnnnnnnnnnnnnnnnnnnnnnnncn

Library Name / Clone Name np / np65403_0309
Flanking Sequence
ANTTACANAAGNTGGNNTGGCNAANTNANCCATTNGCAATTNTATGTTTNGGGGGNNNAA
TAAGAGNGGAGNNCTTTTTGTTTTGNAGGNGNACNCACCCNCNTNTNTTGGNTAANATNN
ATGANNNNNNNTAGNNTTGTGGGTATTAAAGAATTNGNAATTTATTNNNNNNTTGNNTTT
TNNNNTNNTNNNNANNNNNNNNTNATANTNNNNNNNNNNNNANNNAAANANNAAANNANN
TTNATATANNNAAANNAANANNANAANAANANTATAACNANAANNAANANNNANNNTNTN
TTNTTNTNTNTTNTCCCCCAAANANAAAAAAAATTANTTNTTGTGGGGGGGGNGNTAGAA
NNATNNTNTANTTAANANAATTNANAAAAANTAAANNNNANAATTTAAANNNANNNNNAT
TAANNTANNAAAAAATTTTATAANATNNNTNTNNNANANNAANNAANTANTAANNAANAN
NTAANAAATNANANATNATTTTNATATANTTGTTANTNTTTATATTNTTTTATAAAATAA
TNTTTTTTATNNNTATTTATNANAGTNNTTNATNATTTANNTTTTTNNTTTAANAATATT
TATATAANATAAATTTTTNTTATATNNAGGNTATTTTTGTAATTNATTANNTAATTAAAA
ANAANAAANAATTNTATTAAATNANAATGAGAATNNANTATNNTATTNATNNTTNNTGNT
TTANAAGAAAATATATNANNAATATAGAATNANTTTATTTAATGTAAAAANANAATATTT
ANATTAATNNAAAGGAANAAaatnatnagaagaanattaaggnaaaattnataaaanata
naagaagnagtgtataanataaaaataanaagaataggnaggagaaatagnagntnttna
tnnattataanantgaanttantagaggaagtanagaaaaaaanaataagtngtnaatnn
attaataaatanaaanagaganaaagttnagngtnngnatnnggngattntaagtaaaga
taatagnaaaataanaagtaggnatnaaagnaagtatgtgnaagatngaaggtannnaag
aagntnaagtaangattattaagtnagagataaatnnataggataagagaaaaatanana
aaatnagagagtagatggggatagnntaagaangagggaagaggagtnaannnaaannan
tatagaaaggagannagcgcncngcnnccgnnngcgnngnngnng

Image Files
Adult

a1 (->Large)

a2 (->Large)


CLOSE