Detailed Information [113838]

Strain Information
DGRC Number 113838
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}CG11138[NP6081] / FM7c
Genotype y* w* P{w+mW.hs=GawB}CG11138NP6081 / FM7c
Break points/Insertion Site 11B1
Map Viewer
Related Genes CG11138 LIMK1
Original Number 6081
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP6081

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 304
General Information NP_lines
Embryonic Expression weak
Larval GFP sg, midgut.
Larval X-gal sg, ch organ
Adult GFP internal, maibe brain.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np42815_0912
Strand Plus
Insertion Point 12309855
Chromosome Band X
Flanking Sequence
ttcaacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgGAATGGTCAGTCAGTAAATGCATACACACGAACTAGATACA
CACACACACTTAGCCGGCAACACGAAGCGCTGAATGAAACGAAACAAGGAAGAGGGGGAG
GGTGGTAGGTGGGCAAATGAGCGGCGGTGTGGAGTGGGGGTGGCGCGCGCACGTTGCCGT
TCCATTTTATCAGTTTGTACATACTAAAATATACATACATATAGCAACATACAATTTGTA
CAATTTTTCCTCTGTACACCCAGAAAATGTTTGTTATATTTTTAGTATATACACAGACGC
AATAAATATGTACCCGAGTTGGTTTTTTTCCTGTTTTTTTGGTAATGAAACGAATACACA
CAGGAAGGAAGAAGCAGAAGCGTAACGTAAATACAAAACAACAAACGAAATTGGCACAGT
GGGCGTTAGGTGGGAAATTCCAGAAATATGATTGGAATTATTTTCTGTCAAGTTCTTATT
GCCTTTTGTCTGGAAGAAAGCAATTATTCCTATTGGCATTTTGTTTTTAAAGATTTGAGC
AAAGTCAAATTATGTTAACCACGTTATATGATTCAAAAACAAGCCAAGGGATAGAAATAA
TGGAATCTTAAGATAATAGTTCTTTTTCTTATTAAGTTAAGCTTTTGGTTGCCCCACTGT
TTGATGACNGCATCGGTATGAGCGAAAAAGTTTTTTTTTCATCTTGGCTTTAGGGGCTNT
TTTTGGNGGTGGCACTGCAGctcgttccgtaattcgnttccaactnaaaattatctancc
caggtcgactgggtgcgtttgggngnggggggnccanttggtttngnatngngnaaaagg
ggaaaccnnnaaaaagncnnngnnaaaccaaanagntttatgccctttgggc


CLOSE