Detailed Information [113886]
 

Strain Information
DGRC Number 113886
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP6267 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP6267 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 35D1; -; 35D2
Map Viewer
Related Genes CG15258 nht esg
Original Number 6267
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP6267

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1199
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression esg-like, better than 5130 and P127. expressed in nearly all wg, hal cells, tip cells. No / weak leg, gd, gonad expression. oenocyte, muscle. No sg expression.
Larval GFP esg like. hb, leg, wg, hal, genital. fusion cell other than DT not detectable / weak.
Larval X-gal dorsal proximal region of the leg disc, proximal of wing, dorsal and venral regions of eye disc,
Adult GFP strong in hinge, ventral body wall, eye.
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Pitsouli C, Perrimon N.
The homeobox transcription factor cut coordinates patterning and growth during Drosophila airway remodeling.
Sci Signal (2013) 6(263) ra12 [PubMed ID = 23423438] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np44895_0912
Strand Plus
Insertion Point 15311844
Chromosome Band 2L
Flanking Sequence
nggggccnggnggngttnngtttttttggnnngggattttttgggggncaanaacccttt
tttgtatacttncggtaagncttcggctatcgacgggaccaccttatgttatttcatcat
gCTCTCGGCGGAACGCCCGAGAGAGCGTTCTCTTTTGGCAGCTTCGTGTAATGAGCCGAG
TGCCGAGTGCAGGGGCAGTATAAAAAGGCCGCACCACCGCCAAACTCGCTCAGTTATTCC
CAGACTCTAACCGATTCACATAACCATCTCTCCCAACGCAATATACCCGAAATATAACCG
ATATTCAATCGCTTTGCTTAACGGAACACGCGTTTGGTATCTGTGCATCgatcgaagaat
acataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaaggg
caagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctggg
cataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagt
caactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatg
ctgtctcaatgttagaggcatatcagtctccactgagntntttttttttnnggggnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

d2 (->Large)

d3 (->Large)

d4 (->Large)

d5 (->Large)
Embryo

e1 (->Large)

e2 (->Large)

e3 (->Large)

e4 (->Large)

e5 (->Large)

e6 (->Large)

e7 (->Large)
Larval GFP

g1 (->Large)

CLOSE