Strain Information | |
---|---|
DGRC Number | 113886 |
Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}NP6267 / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
Genotype | y* w*; P{w+mW.hs=GawB}NP6267 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
Break points/Insertion Site | 35D1; -; 35D2 |
Map Viewer | ![]() |
Related Genes | CG15258 nht esg |
Original Number | 6267 |
Chromosome | 2 |
Comments | FlyBase Insertion: P{GawB}NP6267 NP line. Received from the National Institute of Genetics. |
Balancer | CyUW14 |
Cluster id | 1199 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | esg-like, better than 5130 and P127. expressed in nearly all wg, hal cells, tip cells. No / weak leg, gd, gonad expression. oenocyte, muscle. No sg expression. |
Larval GFP | esg like. hb, leg, wg, hal, genital. fusion cell other than DT not detectable / weak. |
Larval X-gal | dorsal proximal region of the leg disc, proximal of wing, dorsal and venral regions of eye disc, |
Adult GFP | strong in hinge, ventral body wall, eye. |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Takemura M, Bowden N, Lu YS, Nakato E, O'Connor MB, Nakato H. Drosophila MOV10 regulates the termination of midgut regeneration. Genetics (2021) 218(1) [PubMed ID = 33693718] [RRC reference] Pitsouli C, Perrimon N. The homeobox transcription factor cut coordinates patterning and growth during Drosophila airway remodeling. Sci Signal (2013) 6(263) ra12 [PubMed ID = 23423438] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np44895_0912 |
Strand | Plus |
Insertion Point | 15311844 |
Chromosome Band | 2L |
Flanking Sequence | nggggccnggnggngttnngtttttttggnnngggattttttgggggncaanaacccttt tttgtatacttncggtaagncttcggctatcgacgggaccaccttatgttatttcatcat gCTCTCGGCGGAACGCCCGAGAGAGCGTTCTCTTTTGGCAGCTTCGTGTAATGAGCCGAG TGCCGAGTGCAGGGGCAGTATAAAAAGGCCGCACCACCGCCAAACTCGCTCAGTTATTCC CAGACTCTAACCGATTCACATAACCATCTCTCCCAACGCAATATACCCGAAATATAACCG ATATTCAATCGCTTTGCTTAACGGAACACGCGTTTGGTATCTGTGCATCgatcgaagaat acataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaaggg caagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctggg cataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagt caactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattctatg ctgtctcaatgttagaggcatatcagtctccactgagntntttttttttnnggggnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn |